Perovskite-like mixed oxides La2-x(Sr,Th)(x)CuO4+/-lambda

Two groups of mixed oxides La2-xThxCuO4+/-lambda (0.0 less than or equal to x less than or equal to 0.4) and La2-xSrxCuO4+/-lambda (0.0 less than or equal to x less than or equal to 1.0) were prepared. Their crystal structures were studied with XRD and IR spectra, etc. Meanwhile, the average valence of Cu ions and nonstoichiometric oxygen (lambda) was measured through chemical analyses. Catalysis of the abovementioned mixed oxides was investigated in phenol hydroxylation, good results were obtained for some mixed oxides, and found that the catalysis of these mixed oxides have close relation with their defect structure and composition. A radical substitution mechanism was also proposed for this catalytic reaction.

Relationship between the structure and catalytic activity of La2-xSrxNiO4-lambda(0<=x<=1) mixed oxides for NH3 oxidation

A series of samples having the composition of La2-xSrxNiO4(0 less than or equal to x less than or equal to 1) were prepared and used as catalysts for NH3 oxidation. It was found that the La and oxygen vacancies exist in the La2-xSrxNiO4-lambda(0 less than or equal to x less than or equal to 1). The unit cell volume decreases with the increase of x. For bath c and a parameters there appeared a turning point at x = 0.5. Doping with a lower valence cation Sr2+ in the case of La2NiO4 resulted in an increase of Ni3+, consequently the formation of oxygen vacancies, the increase of reducing ability and the increase of catalytic activity. In the oxygen TPD of La2-xSrxNiO4(0 less than or equal to x less than or equal to 1) appeared three peaks, the alpha' peak at about 400K was attributed to the surplus oxygen desorption, the a peak at 700K which approaches to a maxium at x = 0.6 was attributed to the oxygen adsorbed at oxygen vacancies. The beta peak at about 1000K which depends closely on the x and favors the catalytic activity was attributed to the reduction of Ni3+. The catalytic activity of La-2-x SrxNiO4 mixed oxides in the NH3 oxidation in general could be attributed to the extent of the redox reaction: 2Ni(2+) + O-2 + V-0(..) reversible arrow 2Ni(3+) + 20(-) where V-0(..) representes the oxygen vacancies and O- the oxygen species adsorbed at the vacancies.

A new method for the estimation of oceanic mixed-layer depth using shipboard X-band radar images

Shipboard X-band radar images acquired on 24 June 2009 are used to study nonlinear internal wave characteristics in the northeastern South China Sea. The studied images show three nonlinear internal waves in a packet. A method based on the Radon Transform technique is introduced to calculate internal wave parameters such as the direction of propagation and internal wave velocity from backscatter images. Assuming that the ocean is a two-layer finite depth system, we can derive the mixed-layer depth by applying the internal wave velocity to the mixed-layer depth formula. Results show reasonably good agreement with in-situ thermistor chain and conductivity-temperature-depth data sets.

In situ high temperature X-ray diffraction studies of mixed ionic and electronic conducting perovskite-type membranes

Phase structure and stability of three typical mixed ionic and electronic conducting perovskite-type membranes, SrCo0.8Fe0.2O3-delta (SCF), Ba0.5Sr0.5Co0.8Fe0.2O3-delta (BSCF) and BaCo0.4Fe0.4Zr0.2O3-delta (BCFZ) were studied by in situ high temperature X-ray diffraction at temperatures from 303 to 1273 K and under different atmospheres (air, 2% O-2 in Ar and pure Ar) at 1173 K. By analyzing their lattice parameters the thermal expansion coefficients (TECs) of BSCF, SCF and BCZF are obtained to be 11.5 x 10(-6) K-1, 17.9 x 10(-6) K-1 and 10.3 x 10(-6) K-1, respectively. A relationship between phase stability and TEC was proposed: the higher is the TEC, the lower is the operation stability of the perovskite materials. (C) 2005 Elsevier B.V. All rights reserved.

Development of large-scale colloidal crystallisation methods for the production of photonic crystals

Colloidal photonic crystals have potential light manipulation applications including; fabrication of efficient lasers and LEDs, improved optical sensors and interconnects, and improving photovoltaic efficiencies. One road-block of colloidal selfassembly is their inherent defects; however, they can be manufactured cost effectively into large area films compared to micro-fabrication methods. This thesis investigates production of ‘large-area’ colloidal photonic crystals by sonication, under oil co-crystallization and controlled evaporation, with a view to reducing cracking and other defects. A simple monotonic Stöber particle synthesis method was developed producing silica particles in the range of 80 to 600nm in a single step. An analytical method assesses the quality of surface particle ordering in a semiquantitative manner was developed. Using fast Fourier transform (FFT) spot intensities, a grey scale symmetry area method, has been used to quantify the FFT profiles. Adding ultrasonic vibrations during film formation demonstrated large areas could be assembled rapidly, however film ordering suffered as a result. Under oil cocrystallisation results in the particles being bound together during film formation. While having potential to form large areas, it requires further refinement to be established as a production technique. Achieving high quality photonic crystals bonded with low concentrations (<5%) of polymeric adhesives while maintaining refractive index contrast, proved difficult and degraded the film’s uniformity. A controlled evaporation method, using a mixed solvent suspension, represents the most promising method to produce high quality films over large areas, 75mm x 25mm. During this mixed solvent approach, the film is kept in the wet state longer, thus reducing cracks developing during the drying stage. These films are crack-free up to a critical thickness, and show very large domains, which are visible in low magnification SEM images as Moiré fringe patterns. Higher magnification reveals separation between alternate fringe patterns are domain boundaries between individual crystalline growth fronts.

Reactivity of ammonium chloride/mercuric chloride mixtures with monel containers. The new compounds (NH4)(2)(NH3)(x)[Ni(NH3)(2)Cl-4] and (NH4)(5)Cl-2[CuCl2][CuCl4]

Ammonium chloride/mercuric chloride mixtures (molar ratio 2: 1) react at 350degreesC with Monel (Cu68Ni32) to yield (NH4)NiCl3 and mercury and copper amalgam, respectively. With larger amounts of (NH4)Cl in the reaction mixture, dark green (NH4)(2)(NH3)(x)[Ni(NH3)(2)Cl-4] (x approximate to 0.77) (1) is also formed as a main product. Light blue crystals of the mixed-valent copper(I,II) chloride (NH4)(5)Cl-5[CuCl2][CuCl4] (2) were obtained as a minor byproduct from a 4:1 reaction mixture. The crystal structures were determined from single crystal X-ray data; (1): tetragonal, I4/mmm, a = 770.9(1), e = 794.2(2) pm, 190 reflections, R-1 = 0.0263; (2): tetragonal, I4/mcm, a = 874.8(1), c = 2329.2(3) pm, 451 reflections, R-1 = 0.0736. In (1) Ni2+ resides in trans-[Ni(NH3)(2)Cl-4](2-) octahedra, and in (2) copper(l) is linearly two-coordinated in ECUC121- and copper(II) resides in a flattened tetrahedron [CuCl4](2-) with a tetrahedricity of 89%. (C) 2001 Elsevier Science.

Ultrasonic Study Of The Elastic Properties And Phase Transitions In Selected Mixed Sulphate Crystals

The thesis investigated the elastic properties and phase transitions in selected mixed sulphate crystals – Lithium Hydrazinium Sulphate [LiN2H2SO4], Lithium Ammonium Sulphate [LiNH4SO4] and Lithium Potassium Sulphate [LiKSO4] – using ultrasonic technique. The pulse echo overlap technique has been used for measuring ultrasonic velocity and its dependence on temperature along different directions with waves of longitudinal and transverse polarizations. Two major numerical techniques and the corresponding computer programs developed as part of present work are presented in this thesis. All the 9 elastic constants of LHS are determined accurately from ultrasonic measurements and applying misorientation correction refines the constants. Ultrasonic measurements are performed in LAS to determine the elastic constants and to study the low temperature phase transitions. Temperature variation studies of elastic constant of LAS are performed for 6 different modes of propagation for heating and cooling at low temperatures. All the 5 independent elastic constants of LPS is determined using ultrasonic measurements. It is concluded that LPS crystal does not undergo a phase transition near this temperature. A comparison of the three crystals studied shows that LPS has maximum number of phase transitions and LHS has the least number. It is interesting to note that LPS has the simplest formula unit among the three. There is considerable scope for the future work on these crystals and others belonging to the sulphate family.

Synthesis, reactivity, and X-ray crystal structure of some mixed-ligand oxovanadium(V) complexes: first report of binuclear oxovanadium(V) complexes containing 4,4 '-Bipyridine type bridge

Reaction of the tridentate ONO Schiff-base ligand 2-hydroxybenzoylhydrazone of 2-hydroxybenzoylhydrazine (H2L) with VO(acac)(2) in ethanol medium produces the oxoethoxovanadium(V) complex [VO(OEt)L] (A), which reacts with pyridine to form [VO(OEt)L center dot(py)] (1). Complex 1 is structurally characterized. It has a distorted octahedral O4N2 coordination environment around the V(V) acceptor center. Both complexes A and 1 in ethanol medium react with neutral monodentate Lewis bases 2-picoline, 3-picoline, 4-picoline, 4-amino pyridine, imidazole, and 4-methyl imidazole, all of which are stronger bases than pyridine, to produce dioxovanadium(V) complexes of general formula BH[VO2L]. Most of these dioxo complexes are structurally characterized, and the complex anion [VO2L](-) is found to possess a distorted square pyramidal structure. When a solution/suspension of a BH[VO2L] complex in an alcohol (ROH) is treated with HCl in the same alcohol, it is converted into the corresponding monooxoalkoxo complex [ O(OR)L], where R comes from the alcohol used as the reaction medium. Both complexes A and 1 produce the 4,4'-bipyridine-bridged binuclear complex [VO(OEt)L](2)(mu-4,4'-bipy) (2), which, to the best of our knowledge, represents the first report of a structurally characterized 4,4'-bipyridine-bridged oxovanadium(V) binuclear complex. Two similar binuclear oxovanadium(V) complexes 3 and 4 are also synthesized and characterized. All these binuclear complexes (2-4), on treatment with base B, produce the corresponding mononuclear dioxovanadium(V) complexes (5-10).

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

QCD sum rules for the production of the X(3872) as a mixed molecule-charmonium state in B meson decay

We use QCD sum rules to calculate the branching ratio for the production of the meson X(3872) in the decay B -> X(3872)K, assumed to be a mixture between charmonium and exotic molecular vertical bar c (q) over bar vertical bar vertical bar q (c) over bar vertical bar states with J(PC) = 1(++). We find that in a small range for the values of the mixing angle, 5 degrees <= theta <= 13 degrees, we get the branching ratio B(B -> XK) = (1.00 +/- 0.68) x 10(-5), which is in agreement with the experimental upper limit. This result is compatible with the analysis of the mass and decay width of the mode J/psi(n pi) and the radiative decay mode J/psi gamma performed in the same approach. (C) 2011 Elsevier B.V. All rights reserved.

Polyaniline mixed LB films exposed to X-rays

X-ray irradiation is shown to affect electronic properties of polyaniline (PANi) in composite Langmuir-Blodgett (LB) films of PANi and cadmium stearate, in a similar way to acid doping. The time it takes for the shift in the UV-vis spectra, characteristic of PANi doping, increases linearly with the film thickness, thus indicating a surface-controlled process. The humidity of the environment under which the films are irradiated is also of extreme importance. No shin is observed under vacuum or under dry atmospheres of N-2, O-2 and Ar. For humid environments the time for the shift decreases with increasing relative humidity.

Mixed pseudohalide complexes of copper(II). Crystal and molecular structure of [Cu(N-3)(NCS)(tmen)](n) and of [Cu(N-3)(NCO)(tmen)]2 (tmen = N,N,N ',N '-tetramethylethylenediamine)

The compounds [Cu(N-3)(NSC)(tmen)](n) (1), [Cu(N-3)(NCO)(tmen)](n) (2) and [Cu(N-3)(NCO)(tmen)](2) (3) (tmen = N,N,N',N'-tetramethylethylenediamine) were synthesized and studied by i.r. spectroscopy. Single crystals of compounds (1) and (3) were obtained and characterized by X-ray diffraction. The structure of compound (1) consists of neutral chains of copper(II) ions bridged by a single azido ligand showing the asymmetric end-to-end coordination fashion. Each copper ion is also surrounded by the other three nitrogen atoms: two from one N,N,N',N'-tetramethylethylenediamine and one from a terminal bonded thiocyanate group. Compound (2) decomposes slowly in acetone and the product formed [Cu(N-3)(NCO)(tmen)](2) (3) crystallizes in the monoclinic system (P2(1)). The structure of (3) consists of dimeric units in which the Cu atoms are penta-coordinated and connected by p(1,3) bridging azido and cyanate ligands. In both cases the five coordinated atoms give rise to a slightly distorted square-based pyramid coordination geometry at each copper ion. The thermal behavior of [Cu(N-3)(NSC)(tmen)](n) (1) and [Cu(N-3)(NCO)(tmen)](n) (2) were investigated and the final decomposition products were identified by X-ray powder diagrams.

Resonant x-ray diffraction as a tool to calculate mixed valence ratios: Application to Prussian Blue materials

An approach is proposed here to calculate mixed valence ratios in molecular compounds. Synchrotron x-ray powder diffraction experiments were conducted to determine the Fe(+3)/Fe(+2) ratio in Prussian Blue compounds, which were elected as an example of the use of this approach. As a result, a resonant x-ray diffraction measurement provided direct evidence that the vacant [Fe(CN)(6)] group was randomly absent from similar to 31% of the structure, which was indicated by structural differences caused by variations in the anomalous dispersion term. These findings are very important for a deeper understanding of the changes occurring in properties during in situ compositional variations. (c) 2008 American Institute of Physics.

X-ray-induced conductivity in iron-doped lithium niobate crystals

Illumination of photorefractive, iron-doped lithium niobate crystals (LiNbO 3:Fe) with x-rays generates a conductivity that we determine from the speed of hologram erasure. The doping levels of the crystals and the acceleration voltage of our x-ray tube are varied. A theoretical model is presented, which describes the obtained results. A decrease of the conductivity with increasing Fe 2+ concentration can be explained by assuming that holes are the dominant charge carriers for this short-wavelength illumination.