863 resultados para Tikchik Village site
Resumo:
Background: Syphilis remains a significant cause of preventable perinatal death in developing countries with many women remaining untested and thus untreated. Syphilis testing in the clinic (on-site testing) may be a useful strategy to overcome this. We studied the impact of on-site syphilis testing on treatment delays and rates, and perinatal mortality. Methods: We conducted a cluster randomised controlled trial among seven pairs of primary healthcare clinics in rural South Africa, comparing on-site testing complemented by laboratory confirmation versus laboratory testing alone. Intervention clinics used the on-site test conducted by primary care nurses, with results and treatment available within an hour. Control clinics sent blood samples to the provincial laboratory, with results returned 2 weeks later. Results: Of 7134 women seeking antenatal care with available test results, 793 (11.1%) tested positive for syphilis. Women at intervention clinics completed treatment 16 days sooner on average (95% confidence interval: 11 to 21), though there was no significant difference in the proportion receiving adequate treatment at intervention (64%) and control (69%) clinics. There was also no significant difference in the proportion experiencing perinatal loss (3.3% v 5.1%; adjusted risk difference: -0.9%; 95% Cl -4.4 to 2.7). Conclusions: Despite reducing treatment delays, the addition of on-site syphilis testing to existing laboratory testing services did not lead to higher treatment rates or reduce perinatal mortality. However on-site testing for syphilis may remain an important option for improving antenatal care in settings where laboratory facilities are not available.
Resumo:
The crystal structure of six functionally-distinct enzymes of the DMSO reductase family of molybdenum enzymes has revealed that the tertiary structure of the polypeptide that binds the bis(MGD)Mo cofactor is highly conserved. Differences in the catalytic properties of enzymes of this family are almost certainly dependent upon differences in the structure ofthe MO active site. In DMSO reductase from Rhodobacter species tryptophan- 116 (W 116) hydrogen-bonds to an 0x0 group coordinated to the MO ion. In addition a second amino acid side chain from tyrosine-114 (Y 114) is in close proximity to the 0x0 group. We have investigated the role of Y 114 and W 116 in DMSO reductase using site-directed mutagenesis,
Resumo:
Many drugs and chemicals found in the environment are either detoxified by N-acetyltransferase 1 (NAT1, EC 2.3.1.5) and eliminated from the body or bioactivated to metabolites that have the potential to cause toxicity and/or cancer. NAT1 activity in the body is regulated by genetic polymorphisms as well as environmental factors such as substrate-dependent down-regulation and oxidative stress. Here we report the molecular mechanism for the low protein expression from mutant NAT1 alleles that gives rise to the slow acetylator phenotype and show that a similar process accounts for enzyme down-regulation by NAT1 substrates. NAT1 allozymes NAT1 14, NAT1 15, NAT1 17, and NAT1 22 are devoid of enzyme activity and have short intracellular half-lives (similar to4 h) compared with wild-type NAT1 4 and the active allozyme NAT1 24. The inactive allozymes are unable to be acetylated by cofactor, resulting in ubiquitination and rapid degradation by the 26 S proteasome. This was confirmed by site-directed mutagenesis of the active site cysteine 68. The NAT1 substrate p-aminobenzoic acid induced ubiquitination of the usually stable NAT1 4, leading to its rapid degradation. From this study, we conclude that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state and that mutations in the NAT1 gene that prevent protein acetylation produce a slow acetylator phenotype.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Nest orientation in social insects has been intensively studied in warmer and cooler climates, particularly in the northern hemisphere. Previous studies have consistently shown that species subjected to these climatic conditions prefer to select mostly southern locations where the nests can gain direct sunlight. However, very little is known on nest orientation in tropical and subtropical social insects. We studied nest orientations initiated by swarms throughout a year in a Brazilian swarm-founding wasp, Polybia paulista von Ihering (Hymenoptera: Polistinae). Swarms selected various orientations as nest sites, but there was a particular trend in that swarms in the winter period (May-August) preferred to build northward-facing nests. This preference is opposite from that of social wasps observed in the northern hemisphere. Colonies of this species can potentially last for many years with continuous nesting, but nesting activities of colonies during the winter are severely limited due to cool temperature and a shortened day length. Northward-facing nests are warmer through the gain of direct solar heat during the winter period; consequently, choosing northward-facing sites may be advantageous for swarms in terms of a shortened brood development and shortened time needed to increase metabolic rates during warm-up for flight.
Resumo:
Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.
Resumo:
Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.
Resumo:
BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.
Resumo:
Background: Structural and inflammatory changes in asthma involve both the large and small airways, with involvement of the distal lung being related to disease severity. We have previously shown that changes in the extracellular matrix (ECM) composition of the distal lung are associated with loss of alveolar attachments in patients with fatal asthma. However, major ECM elements, such as collagen I and fibronectin and their regulators, have not been addressed at the distal level. Objective: We sought to evaluate ECM remodeling in the distal lungs of asthmatic patients. Methods: Using immunohistochemistry and image analysis, we determined the content of collagen I and III, fibronectin, and matrix metalloproteinases; (MMPs) 1, 2, and 9 and tissue inhibitors of metalloproteinase (MMPs) 1 and 2 in the large and small airways and lung parenchyma of 24 patients with fatal asthma and compared the results with those of 11 nonasthmatic control subjects. Protein content was defined as the area of positive staining divided by basement membrane or septum length. Results: We observed increased collagen I and decreased collagen III content in the small airways of asthmatic patients compared with that seen in control subjects. Greater fibronectin and MMP-1, MMP-2, and MMP-9 content was observed at the outer area of the small airways in asthmatic patients. NIMP content was also increased in the peribronchiolar parenchyma in asthmatic patients. In contrast, TIMP expression was only increased in the large airways of asthmatic patients compared with that seen in control subjects. Conclusions: The outer area of the small airways is a major site of ECM remodeling in fatal asthma, potentially contributing to functional changes and the loss of airway-parenchyma interdependence observed in patients with fatal asthma. (J Allergy Clin Immunol 2009;123:1090-7.)