Implementación de un método cuantitativo para la detección del virus Psorosis de cítricos mediante RT-PCR tiempo real y su evaluación en muestras de campo

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Dédoublement et métamorphoses dans Chroniques de l'oiseau à ressort de Haruki Murakami et Le rêve de Mircea Cărtărescu

Mémoire numérisé par la Division de la gestion de documents et des archives de l'Université de Montréal

Otimização da RT-PCR Multiplex para detecção de vírus dengue em amostras de Aedes aegypti infectados artificialmente

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

Detection of tobacco mosaic tobamovirus in cigarettes through RT-PCR

TMV was tried to recover from a variety of branded cigarettes and cigars. Tobacco from six different brands of cigarettes and cigar were processed and reverse transcriptase polymerase chain reaction was employed for the detection of TMV. RTPCR confirmed the presence of TMV in tobacco from one brand of cigarette and one brand of cigar. Bean plants (Phaseolus vulgaris) were inoculated manually with tobacco sap of cigarettes resulting in the production of localized disease lesions. Together, these results showed that tobacco used to make cigarettes and cigars can function as an effective disease vector, potentially aiding the movement of infectious TMV between countries. This is an important finding prompting a need to test smoking tobacco for other virus particles that infect tobacco plants and survive processing as well as considering biosecurity measures to limit virus transmission

Evaluation of Quantitative RT-PCR Using Nonamplified and Amplified RNA

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Detection of hantaviruses in Brazilian rodents by SYBR-Green-based real-time RT-PCR

Current knowledge of the pathogenic hantavirus indicates that wild rodents are its primary natural reservoir. Specific primers to detect the presence of viral genomes were developed using an SYBR-Green-based real-time RT-PCR protocol. One hundred sixty-four rodents native to the Atlantic Forest biome were captured in So Paulo State, Brazil, and their tissues were tested. The presence of hantavirus RNA was detected in sixteen rodents: three specimens of Akodon montensis, three of Akodon cursor, two of Necromys lasiurus, one of Juliomys sp., one of Thaptomys nigrita, five of Oligoryzomys nigripes, and one of Oryzomys sp. This SYBR Green real-time RT-PCR method for detection of hantavirus may be useful for surveying hantaviruses in Brazil.

Bcl-2 expression and apoptosis induction in human HL60 leukaemic cells treated with a novel organotellurium(IV) compound RT-04

Organotellurium(]V) compounds have been reported to have multiple biological activities including cysteine protease-inhibitory activity, mainly cathepsin B. As cathepsin B is a highly predictive indicator for prognosis and diagnosis of cancer, a possible antitumor potential for these new compounds is expected. In this work, it was investigated the effectiveness of organotellurium(IV) RT-04 to produce lethal effects in the human promyelocytic leukaemia cell line HL60. Using the MTT tetrazolium reduction test, and trypan blue exclusion assay, the IC50 for the compound after 24 h incubation was 6.8 and 0.35 mu M, respectively. Moreover, the compound was found to trigger apoptosis in HL60 cells, inducing DNA fragmentation and caspase-3, -6, and -9 activations. The apoptsosis-induced by RT-04 is probably related to the diminished Bcl-2 expression, observed by RT-PCR, in HL60-treated cells. In vivo studies demonstrated that the RT-04 treatment (2.76 mg/kg given for three consecutive days) produces no significant toxic effects for bone marrow and spleen CFU-GM. However, higher doses (5.0 and 10 mg/kg) produced a dose-dependent reduction in the number of CFU-GM of RT-04-treated mice. These results suggest that RT-04 is able to induce apoptosis in HL60 cells by Bcl-2 expression down-modulation. Further studies are necessary to better clarify the effects of this compound on bone marrow normal cells. (C) 2008 Elsevier Ltd. All rights reserved.

Öppna test jämfört med blindtest : Hur påverkas lyssnarens bedömning?

Denna undersökning söker ett svar på hur den relativt vana lyssnarens bedömning av ljudkvalitet påverkas av ett så kallat öppet test, där det som bedöms är känd för lyssnaren, jämfört med ett blindtest, där detta objekt är okänt. Frågan appliceras på kvalitetsbedömningen av digitala kodningstekniker, d.v.s. hur lyssnaren påverkas av att valet av kodningsteknik som avlyssnas är känd eller inte. För att ta reda på detta genomfördes ett lyssningstest med nio deltagare. Deltagarna fick betygssätta perceptuellt kodade ljudfiler mot en känd referens, både som ett blindtest samt i ett öppet test. Resultatet är mångtydigt och inga generella slutsatser för hur lyssnaren påverkas av ett öppet test jämfört med ett blindtest går att uppfatta. Resultatet visar dock att påverkan ett öppet test har på lyssnarens bedömning är högst individuell. Lyssningstest i form av blindtest bör därför användas för att uppnå pålitligast resultat. 

Caracterização parcial de um fragmento e detecção por RT-PCR de Rice Stripe Necrosis Virus

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Diagnóstico das propriedades de consistência temporal em DMI`s: uma abordagem baseada na TDF RT-LOTOS

Orientador: Paulo Nazareno Maia Sampaio

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)