The Las Campanas/AAT rich cluster survey - I. Precision and reliability of the photometric catalogue

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

The Las Campanas/AAT Rich Cluster Survey - II. The environmental dependence of galaxy colours in clusters at z similar to 0.1

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Dermaseptin 01 as antimicrobial peptide with rich biotechnological potential: study of peptide interaction with membranes containing Leishmania amazonensis lipid-rich extract and membrane models

This article addresses the interactions of the synthetic antimicrobial peptide dermaseptin 01 (GLWSTIKQKGKEAAIAAA-KAAGQAALGAL-NH(2), DS 01) with phospholipid (PL) monolayers comprising (i) a lipid-rich extract of Leishmania amazonensis (LRE-La), (ii) zwitterionic PL (dipalmitoylphosphatidylcholine, DPPC), and (iii) negatively charged PL (dipalmitoylphosphatidylglycerol, DPPG). The degree of interaction of DS 01 with the different biomembrane models was quantified from equilibrium and dynamic liquid-air interface parameters. At low peptide concentrations, interactions between DS 01 and zwitterionic PL, as well as with the LRE-La monolayers were very weak, whereas with negatively charged PLs the interactions were stronger. For peptide concentrations above 1 mu g/ml, a considerable expansion of negatively charged monolayers occurred. In the case of DPPC, it was possible to return to the original lipid area in the condensed phase, suggesting that the peptide was expelled from the monolayer. However, in the case of DPPG, the average area per lipid molecule in the presence of DS 01 was higher than pure PLs even at high surface pressures, suggesting that at least part of DS 01 remained incorporated in the monolayer. For the LRE-La monolayers, DS 01 also remained in the monolayer. This is the first report on the antiparasitic activity of AMPs using Langmuir monolayers of a natural lipid extract from L. amazonensis. Copyright (C) 2011 European Peptide Society and John Wiley & Sons, Ltd.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Safety of oral glutamine in the abbreviation of preoperative fasting; a double-blind, controlled, randomized clinical trial

Introduction: No study so far has tested a beverage containing glutamine 2 h before anesthesia in patients undergoing surgery. Objectives: The aim of the study was to investigate: 1) the safety of the abbreviation of preoperative fasting to 2 h with a carbohydrate-L-glutamine-rich drink; and 2) the residual gastric volume (RGV) measured after the induction of anesthesia for laparoscopic cholecystectomies. Methods: Randomized controlled trial with 56 women (42 (17-65) years-old) submitted to elective laparoscopic cholecystectomy. Patients were randomized to receive either conventional preoperative fasting of 8 hours (fasted group, n = 12) or one of three different beverages drunk in the evening before surgery (400 mL) and 2 hours before the initiation of anesthesia (200 mL). The beverages were water (placebo group, n = 12), 12.5% (240 mOsm/L) maltodextrine (carbohydrate group, n = 12) or the latter in addition to 50 g (40 g in the evening drink and 10g in the morning drink) of L-glutamine (glutamine group, n = 14). A 20 F nasogastric tube was inserted immediately after the induction of general anesthesia to aspirate and measure the RGV. Results: Fifty patients completed the study. None of the patients had either regurgitation during the induction of anesthesia or postoperative complications. The median (range) of RGV was 6 (0-80) mL. The RGV was similar (p = 0.29) between glutamine group (4.5 [0-15] mL), carbohydrate group (7.0 [0-80] mL), placebo group (8.5 [0-50] mL), and fasted group (5.0 [0-50] mL). Conclusion: The abbreviation of preoperative fasting to 2 h with carbohydrate and L-glutamine is safe and does not increase the RGV during induction of anesthesia. (Nutr Hosp. 2011;26:86-90) DOI:10.3305/nh.2011.26.1.4993

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.

Metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein in young obese and normal-weight patients with polycystic ovary syndrome

Objective: To clarify whether the metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein (HDL) are altered in patients with polycystic ovary syndrome (PCOS). Design: Case control study. Setting: Endocrinology clinics. Patient(s): Eight normal-weight (NW) and 15 obese (013) patients with PCOS were compared with 10 NW and 10 Ob women without PCOS paired for age and body mass index. Intervention(s): Determination of triglyceride-rich lipoprotein metabolism and lipid transfer to HDL. Main Outcome Measure(s): Participants were injected triglyceride-rich emulsions labeled with (14)C-cholesteryl esters and (3)H-triglycerides and the fractional clearance rate (FCR, in min(-1)) of labels was determined. Lipid transfer from artificial nanoemulsions to HDL was performed by incubating radioactively labeled lipid nanoemulsions with plasma during 1 hour, followed by radioactive counting of HDL-containing supernatant after chemical precipitation. Result(s): Lipolysis estimated by triglyceride FCR was equal in PCOS groups (NW = 0.043 +/- 0.032, Ob = 0.033 +/- 0.009) and respective controls (NW = 0.039 +/- 0.015, Ob = 0.044 +/- 0.019). However, the remnant removal as estimated by cholesteryl ester FCR was reduced in both PCOS groups (NW = 0.005 +/- 0.006, Ob = 0.005 +/- 0.005) compared with controls (NW = 0.016 +/- 0.006, Ob = 0.011 +/- 0.072). Lipid transfer rates were not different among groups, but triglyceride transfer rates were positively correlated with homeostasis model assessment estimate of insulin resistance in PCOS. Conclusion(s): PCOS patients showed decreased removal of atherogenic remnants even when fasting glucose was <100 mg/dL. This reinforces the usefulness of the measures taken to prevent cardiovascular events in PCOS patients. (Fertil Steril (R) 2010;93:1948-56. (C)2010 by American Society for Reproductive Medicine.)

Use of cholesterol-rich nanoparticles that bind to lipoprotein receptors as a vehicle to paclitaxel in the treatment of breast cancer: pharmacokinetics, tumor uptake and a pilot clinical study

Purpose In animal experiments paclitaxel oleate associated with a cholesterol-rich nanoemulsion concentrated in the neoplastic tissues and showed reduced toxicity and increased antitumor activity compared with paclitaxel-Cremophor EL. Here, a clinical study was performed in breast cancer patients to evaluate the tumoral uptake, pharmacokinetics and toxicity of paclitaxel associated to nanoemulsions. Methods Twenty-four hours before mastectomy [(3)H]paclitaxel oleate associated with [(14)C]-cholesteryl oleatenanoemulsion or [(3)H]- paclitaxel in Cremophor EL were injected into five patients for collection of blood samples and fragments of tumor and normal breast tissue. A pilot clinical study of paclitaxel-nanoemulsion administered at 3-week intervals was performed in four breast cancer patients with refractory advanced disease at 175 and 220 mg/m(2) dose levels. Results T(1/2) of paclitaxel oleate associated to the nanoemulsion was greater than that of paclitaxel (t(1/2) = 15.4 +/- 4.7 and 3.5 +/- 0.80 h). Uptake of the [(14)C]-cholesteryl ester nanoemulsion and [(3)H]- paclitaxel oleate by breast malignant tissue was threefold greater than the normal breast tissue and toxicity was minimal at the two dose levels. Conclusions Our results suggest that the paclitaxel-nanoemulsion preparation can be advantageous for use in the treatment of breast cancer because the pharmacokinetic parameters are improved, the drug is concentrated in the neoplastic tissue and the toxicity of paclitaxel is reduced.