992 resultados para HELPER-CELLS


Relevância:

60.00% 60.00%

Publicador:

Resumo:

OBJECTIVE: The importance of the costimulatory molecules CD28 and CTLA-4 in the pathologic mechanism of rheumatoid arthritis (RA) has been demonstrated by genetic associations and the successful clinical application of CTLA-4Ig for the treatment of RA. This study was undertaken to investigate the role of the CTLA-4/CD28 axis in the local application of CTLA-4Ig in the synovial fluid (SF) of RA patients. METHODS: Quantitative polymerase chain reaction was used to analyze the expression of proinflammatory and antiinflammatory cytokines in ex vivo fluorescence-activated cell sorted CTLA-4+ and CTLA-4- T helper cells from the peripheral blood and SF of RA patients. T helper cells were also analyzed for cytokine expression in vitro after the blockade of CTLA-4 by anti-CTLA-4 Fab fragments or of B7 (CD80/CD86) molecules by CTLA-4Ig. RESULTS: CTLA-4+ T helper cells were unambiguously present in the SF of all RA patients examined, and they expressed increased amounts of interferon-γ (IFNγ), interleukin-17 (IL-17), and IL-10 as compared to CTLA-4- T helper cells. The selective blockade of CTLA-4 in T helper cells from the SF in vitro led to increased levels of IFNγ, IL-2, and IL-17. The concomitant blockade of CD28 and CTLA-4 in T helper cells from RA SF by CTLA-4Ig in vitro resulted in reduced levels of the proinflammatory cytokines IFNγ and IL-2 and increased levels of the antiinflammatory cytokines IL-10 and transforming growth factor β. CONCLUSION: Our ex vivo and in vitro results demonstrate that the CTLA-4/CD28 axis constitutes a drug target for not only the systemic, but potentially also the local, application of the costimulation blocking agent CTLA-4Ig for the treatment of RA.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Only limited data are available about the precise mechanism leading to tissue inflammation and damage in patients with hidradenits suppurativa (HS). The central pathogenetic event in HS is the occlusion of the upper parts of the hair follicle leading to a perifollicular lympho-histiocytic inflammation. In early lesions, neutrophilic abscess formation and influx of mainly macrophages, monocytes and dendritic cells predominate. In chronic disease, the infiltrate expand with increased frequencies of B cells and plasma cells. In the inflammatory infiltrates toll like receptor 2 (TLR2) was highly expressed by infiltrating macrophages and dendritic cells indicating that stimulation of inflammatory cells by TLR2 activating microbial products may be important trigger factors in the chronic inflammatory process. Furthermore, the pro inflammatory cytokines IL-12 and IL-23 are abundantly expressed by macrophages infiltrating papillary and reticular dermis of HS skin. Both of these cytokines are believed to be important mediators in autoimmune tissue destruction and its blocking by biologics has been shown to be effective in the treatment of psoriasis. Especially IL-23 has been shown to be involved in the induction of a T helper cell subset producing IL-17, therefore, named Th17, which is distinct from the classical Th1/Th2 subsets. In chronic HS lesions IL-17-producing T helper cells were found to infiltrate the dermis. An overexpression of various other cytokines like IL-1beta, CYCL9 (MIG), IL-10 , IL-11 and BLC has been described in HS lesion whereas IL-20 and IL-22 have been shown to be down regulated. Similar to psoriasis also in HS the antimicrobial peptides beta defensin 2 and psoriasin are highly upregulated. This may at least in part explain the clinical finding that HS patients suffer only rarely from skin infections. Taken together the inflammatory reaction leading to HS are only poorly understood, but they show many similarity with other inflammatory reactions as e.g. in psoriasis.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The protozoan Leishmania mexicana parasite causes chronic non-healing cutaneous lesions in humans and mice with poor parasite control. The mechanisms preventing the development of a protective immune response against this parasite are unclear. Here we provide data demonstrating that parasite sequestration by neutrophils is responsible for disease progression in mice. Within hours of infection L. mexicana induced the local recruitment of neutrophils, which ingested parasites and formed extracellular traps without markedly impairing parasite survival. We further showed that the L. mexicana-induced recruitment of neutrophils impaired the early recruitment of dendritic cells at the site of infection as observed by intravital 2-photon microscopy and flow cytometry analysis. Indeed, infection of neutropenic Genista mice and of mice depleted of neutrophils at the onset of infection demonstrated a prominent role for neutrophils in this process. Furthermore, an increase in monocyte-derived dendritic cells was also observed in draining lymph nodes of neutropenic mice, correlating with subsequent increased frequency of IFNγ-secreting T helper cells, and better parasite control leading ultimately to complete healing of the lesion. Altogether, these findings show that L. mexicana exploits neutrophils to block the induction of a protective immune response and impairs the control of lesion development. Our data thus demonstrate an unanticipated negative role for these innate immune cells in host defense, suggesting that in certain forms of cutaneous leishmaniasis, regulating neutrophil recruitment could be a strategy to promote lesion healing.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Although porcine circovirus type 2 (PCV2)-associated diseases have been evaluated for known immune evasion strategies, the pathogenicity of these viruses remained concealed for decades. Surprisingly, the same viruses that cause panzootics in livestock are widespread in young, unaffected animals. Recently, evidence has emerged that circovirus-like viruses are also linked to complex diseases in humans, including children. We detected PCV2 genome-carrying cells in fetal pig thymi. To elucidate virus pathogenicity, we developed a new pig infection model by in vivo transfection of recombinant PCV2 and the immunosuppressant cofactor cyclosporine A. Using flow cytometry, immunofluorescence and fluorescence in situ hybridization, we found evidence that PCV2 dictates positive and negative selection of maturing T cells in the thymus. We show for the first time that PCV2-infected cells reside at the corticomedullary junction of the thymus. In diseased animals, we found polyclonal deletion of single positive cells (SPs) that may result from a loss of major histocompatibility complex class-II expression at the corticomedullary junction. The percentage of PCV2 antigen-presenting cells correlated with the degree of viremia and, in turn, the severity of the defect in thymocyte maturation. Moreover, the reversed T-cell receptor/CD4-coreceptor expression dichotomy on thymocytes at the CD4(+)CD8(interm) and CD4SP cell stage is viremia-dependent, resulting in a specific hypo-responsiveness of T-helper cells. We compare our results with the only other better-studied member of Circoviridae, chicken anemia virus. Our data show that PCV2 infection leads to thymocyte selection dysregulation, adding a valuable dimension to our understanding of virus pathogenicity.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Gut was studied as a prototypical mucosal membrane in the murine BDF-1 syngeneic bone marrow transplant model. Measures of jejunal intraepithelial lymphocytes (IELs) and crypt cells were obtained by standard techniques and a method of quantifying gut lamina propria plasma cells (PCs) was developed. The degree of ablation of gut PCs and IELs after 900 rads total body irradiation with ('60)Co, and their repopulation effected by transplantation with 2.0 x 10('5) or 1.0 x 10('6) bone marrow cells demonstrated a prolonged period of profound depression in population levels of these cells which was not reflected by the extent of damage sustained to the epithelium. Differences in the depopulation and recovery of gut PCs and IELs revealed a tendency towards initial differentiation of effector cells. A positive dose response to high bone marrow cell innocula was obtained. Subsequent studies determined that gut IEL and PC repopulation was potentiated by the addition of IELs or buffy coat cells (BCs) to the bone marrow transplant. A method of isolating 1.4 - 4.0 x 10('7) viable IELs per gram of murine small bowel was devised employing intralumenal hyaluronidase digestion of the epithelial layer and centrifugation of the resulting suspension through discontinuous Percoll gradients. Irradiated mice received 2.0 x 10('5) bone marrow cells along with an equal number of IELs or BCs. The extent and duration of depression of numbers of IELs and PCs was markedly reduced by the addition of the IEL isolate to the transplantation innocula, and to a lesser degree by the addition of BCs. The augmentation of repopuation far exceeded that expected by simple lodging of cells suggesting that the additionally transplanted cells contained a subpopulation of mucosal membrane lymphoid stem cells or helper cells. Correlation analysis of PC versus IEL levels suggests a possible feedback mechanism governing the relative size of their populations. Normal ratios of IgA, IgM, and IgG bearing PCs was maintained post transplantation with all of the regimens. ^

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We use mathematical models to study the relationship between HIV and the immune system during the natural course of infection and in the context of different antiviral treatment regimes. The models suggest that an efficient cytotoxic T lymphocyte (CTL) memory response is required to control the virus. We define CTL memory as long-term persistence of CTL precursors in the absence of antigen. Infection and depletion of CD4+ T helper cells interfere with CTL memory generation, resulting in persistent viral replication and disease progression. We find that antiviral drug therapy during primary infection can enable the development of CTL memory. In chronically infected patients, specific treatment schedules, either including deliberate drug holidays or antigenic boosts of the immune system, can lead to a re-establishment of CTL memory. Whether such treatment regimes would lead to long-term immunologic control deserves investigation under carefully controlled conditions.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Mutations of the Bruton's tyrosine kinase (btk) gene cause X-linked agammaglobulinemia (XLA) in humans and X-linked immune deficiency (Xid) in mice. To establish the BTK role in B-cell activation we examined the responses of wild-type and Xid B cells to stimulation through surface IgM and CD40, the transducers of thymus independent-type 2 and thymus-dependent activation, respectively. Wild-type BTK was necessary for proliferation induced by soluble anti-IgM (a prototype for thymus independent-type 2 antigen), but not for responses to soluble CD40 ligand (CD40L, the B-cell activating ligand expressed on T-helper cells). In the absence of wild-type BTK, B cells underwent apoptotic death after stimulation with anti-IgM. In the presence of wild-type but not mutated BTK, anti-IgM stimulation reduced apoptotic cell death. In contrast, CD40L increased viability of both wild-type and Xid B cells. Importantly, viability after stimulation correlated with the induced expression of bcl-XL. In fresh ex vivo small resting B cells from wild-type mice there was only barely detectable bcl-XL protein, but there was more in the larger, low-density ("activated") splenic B cells and peritoneal B cells. In vitro Bcl-XL induction following ligation of sIgM-required BTK, was cyclosporin A (CsA)-sensitive and dependent on extracellular Ca2+. CD40-mediated induction of bcl-x required neither wild-type BTK nor extracellular Ca2+ and was insensitive to CsA. These results indicate that BTK lies upstream of bcl-XL in the sIgM but not the CD40 activation pathway. bcl-XL is the first induced protein to be placed downstream of BTK.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Recombinant adenoviruses are attractive vehicles for liver-directed gene therapy because of the high efficiency with which they transfer genes to hepatocytes in vivo. First generation recombinant adenoviruses deleted of E1 sequences also express recombinant and early and late viral genes, which lead to development of destructive cellular immune responses. Previous studies indicated that class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTLs) play a major role in eliminating virus-infected cells. The present studies utilize mouse models to evaluate the role of T-helper cells in the primary response to adenovirus-mediated gene transfer to the liver. In vivo ablation of CD4+ cells or interferon gamma (IFN-gamma) was sufficient to prevent the elimination of adenovirus-transduced hepatocytes, despite the induction of a measurable CTL response. Mobilization of an effective TH1 response as measured by in vitro proliferation assays was associated with substantial upregulation of MHC class I expression, an effect that was prevented in IFN-gamma-deficient animals. These results suggest that elimination of virus-infected hepatocytes in a primary exposure to recombinant adenovirus requires both induction of antigen-specific CTLs as well as sensitization of the target cell by TH1-mediated activation of MHC class I expression.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The logical (or logic) formalism is increasingly used to model regulatory and signaling networks. Complementing these applications, several groups contributed various methods and tools to support the definition and analysis of logical models. After an introduction to the logical modeling framework and to several of its variants, we review here a number of recent methodological advances to ease the analysis of large and intricate networks. In particular, we survey approaches to determine model attractors and their reachability properties, to assess the dynamical impact of variations of external signals, and to consistently reduce large models. To illustrate these developments, we further consider several published logical models for two important biological processes, namely the differentiation of T helper cells and the control of mammalian cell cycle.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Kidney transplantation is the best treatment for patients who have lost kidney function. Renal transplant patients require accurate immunosuppressive drugs to prevent rejection. In this process T helper cells of the immune system perform key role in the immune response to the graft, and recently the Th17 cells has been investigated by production of IL-17 potent proinflammatory cytokine whose role in the rejection has also been described. Increased of Th17 cell expression has an important association with the development of rejection in renal microenvironment, however the likely mechanism is not well understood. This study aimed to evaluate the Th17 response from the influence of the chemotactic axis CCR6/CCL20 and genetic variants in IL-17 and IL-17RA. We conducted a case-control study involving 148 patients transplanted at the University Hospital Onofre Lopes/UFRN in which assessed by immunohistochemistry protein expression of IL-17 and chemokines CCR6/CCL20 and by PCR-RFLP genetic variants in IL17A and IL17RA. Our results showed no influence of genetic polymorphisms on the outcome of the graft or the protein expression of IL-17. In renal graft microenvironment found several sources producing IL-17: tubular epithelial cells, glomerular cells, neutrophils and cell interstitial infiltration, in turn the expression of chemotactic axis CCR6/CCL20 was restricted to the tubular epithelium cells. There was a slight positive linear correlation between the presence of IL-17 and expression of chemotactic axis CCR6/CCL20 in the microenvironment of renal graft. Therefore, we believe that, combined with our results, further studies with increased "n" sample and greater control over the variables involved in obtaining the renal specimen, can determine more clearly the influence of chemotactic axis CCR6 / CCL20 and polymorphisms in cytokines related to Th17 profile on the control of this cell subtype response in rejection processes to renal allograft.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Inbred strains of C5731 and NIH nice infected with the A/S strain of Plasmodium chaubaudi usually developed high parasitaemias but infections were rarely fatal in immunocompetent mice and in most mice the parasites could be eradicated within 53 days or less. The immune response of C57B1 and NTH mice to infection with the A/S strain of P. chabaudi was studied. The principle method used in this study for investigating the immune response of the mice was to examine the immunity conferred on syngeneic mice, either X-irradiated or non-irradiated, by transferring to them lymphoid cells or serum from immune or semi-immune donors. The lymphoid cell populations examined were unfractionated spleen cells, nylon wool column enriched subpopulations of thymus-derived lymphocytes (T cells) and the so-called bursa-derived lymphocytes (B cells), bone marrow cells and phagocytic cells. In the course of these experiments observations were made on the effect of X-irradiation on the subsequent growth and multiplication of the parasite. In addition, an in vitro assay for antibody-dependent cell mediated cytotoxicity was used to investigate the activity of splenic K cells during malaria infection. K cells are lymphoid cells which may include lymphocytes of an undefined category, but possess receptors for the Fc portion of antibody on their surface and have the ability to non-specifically lyse target cells coated in antibodies. a) The adoptive transfer of immunity to P.chabaudi with immune spleen cells. Spleen cells from mice which had previously been infected with P.chabaudi were able to confer some immunity on syngeneic mice which had been irradiated with 600 or 800 rads. The protection was detected as a shortened patent parasitaemia in immune cell recipients compared to controls. The early experiments indicated the value of using irradiated recipients rather than non-irradiated recipients. In irradiated mice, a) smaller numbers of immune cells were required to promote detectable immunity than in non-irradiated mice, b) there was an amplification of the difference in the duration of primary parasitaemias in recipients of immune cells and normal cells compared to non-irradiated mice and c) as the irradiated host is immunodepressed, the protective effect of donor cells can be examined with a reduced contribution by the hosts own immune system. An initial non-specific resistance to P.chabaudi infection was observed in irradiated mice, although the infection in most of these mice was subsequently more severe than in non-irradiated mice. The non-specific resistance could be reduced or abolished by injecting lymphoid cells into mice shortly after irradiation or by infecting irradiated mice more than 15 days after irradiation. Other workers suggest that following irradiation, the reticulo-endothelial system is stimulated at the time that the non-specific resistance to P.chabaudi was observed. b) the adoptive transfer of immunity in syngeneic mice with enriched subpopulations of splenic immune T cells, B. cells, bone marrow cells and phagocytes. Immunity to P.chabaudi could be adoptively transferred with enriched spleen subpopulations of immune T cells or immune B cells in mice which had been irradiated 600 or 300 rads. The protective effects of unfractionated immune cells was, however, usually better than that of either immune T or F cell subpopulations. In most experiments enriched immune T cell recipients were more likely to suffer relapsing patent parasitaemias than either enriched immune B cell recipients or unfractionated immune cell recipients. In one experiment a comparison was made of the course of P.chabaudi infection in mice which had been irradiated with either 600 rads or 300 rads and which received injections of different immune cells. A dose of 600 rads permits the immune system of mice to recover from the effects of irradiation, but a dose of 800 rads is lethal to mice unless lymphoid cells are injected after irradiation. It was found that in recipients of enriched immune T or B cells, which had been irradiated with 600 rads, the parasitaemia became subpatent before their equivalents irradiated with 800 rads, but that there was little difference in parasitaemias between recipients of unfractionated immune cells given 600 or 800 rads. Experiments in which enriched immune T cells and B cells were recombined and injected into syngeneic mice gave inconclusive results as to whether the immune subpopulations acted synergistically. Similar experiments in which immune subpopulations of lymphoid cells were recombined with normal subpopulations of lymphoid cells demonstrated that the latter cells did not enhance the protective effect of the former cells. Bone marrow cells from immune mice were able to confer some protection on syngeneic recipients, but were not as protective as enriched immune T cells or B cells. The results obtained in adoptive transfer experiments using phagocytic cells from the spleen of immune mice depended on the length of time spleen cells were incubated in petri-dishes at 37° C before harvesting the phagocytes. Using C57B1 mice, phagocytes harvested after 15 hours incubation were as protective as unfractionated immune cells in a cell transfer experiment, but phagocytes harvested after 16 hours incubation were not protective. Examination of NIH phagocytic cells after 2.5 hours incubation at 37°C, which were as protective as unfractionated immune spleen cells in a cell transfer experiment, demonstrated that the petri-dish adherent cells may have contained B lymphocytes. c) The passive transfer of immunity with serum from P.chabaudi infected mice. The passive transfer of serum from C57B1 mice which had been previously infected with P.chabaudi to normal or irradiated syngeneic mice demonstrated that the serum recipients were initially protected from infection. Irradiated mice, however, were delayed longer in the onset of parasitaemia compared to non-irradiated mice. Using NIH mice, sera were collected from unfractionated immune spleen cell recipients, enriched immune T cell recipients and normal spleen recipients on the 11th day of a P.chabaudi infection, just after peak parasitaemia, and also on the 14th day of infection. On day 14, all immune cells recipients and most of the enriched immune T cell recipients had become subpatent but all normal cell recipients still had patent infections. Sera collected from the different spleen cell recipients on the 11th day of infection and passively transferred to irradiated mice demonstrated little protection. Sera collected on the 14th day of infect ion, however, reflected the immune status of the donors in their protective properties in mice infected with P.chabaudi. The serum from unfractionated immune cell recipients was the most protective of the 3 sera when compared to normal NIH serum and the serum from enriched immune T cell recipients was slightly protective, but the serum from normal cell recipients produced an enhanced infection in mice infected with P.chabaudi. d) Antibody-dependent cell-mediated cytotoxicity of spleen cells in P.chabaudi infected mice. In a preliminary investigation of K cell activity in the spleens of P.chabaudi infected mice, it was found that there was an increased activity of K cells collected at around peak parasitaemia compared to the activity of K cells in non-infected mice, and that this increased activity could also be found in mice which had recently become subpatent. As the target cell for antibody-dependent cell-mediated cytotoxicity employed was the thick red blood cell, it is not known whether the K cell is involved in the killing of P.chabaudi parasites. These results suggest that both T cells and B cells and antibody may be important in the immune response to P.chabaudi in mice. Primed T cells may act as helper cells in the production of malarial antibodies, but, as enriched primed T cells could confer protection on immunodepressed mice, it is possible that a cell-mediated mechanism of immunity may also exist.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Dietary fiber was classified according to its solubility in an attempt to relate physiological effects to chemical types of fiber. Soluble fibers (B-glucans, gums, wheat dextrin, psyllium, pectin, inulin) were considered to have benefits on serum lipids, while insoluble fibers (cellulose, lignin, pectins, hemicelluloses) were linked with laxation benefits. More important characteristics of fiber in terms of physiological benefits are viscosity and fermentability. Viscous fibers (pectins, B-glucans, gums, psyllium) are those that have gel-forming properties in the intestinal tract, and fermentable fibers (wheat dextrin, pectins, B-glucans, gum, inulin) are those that can be metabolized by colonic bacteria. Objective: To summarize the beneficial effects of dietary fiber, as nutraceuticals, in order to maintain a healthy gastrointestinal system. Methods: Our study is a systematic review. Electronic databases, including PubMed, Medline, with supplement of relevant websites, were searched. We included randomized and non-randomized clinical trials, epidemiological studies (cohort and case-control). We excluded case series, case reports, in vitro and animal studies. Results: The WHO, the U.S. Food and Drug Administration (FDA), the Heart Foundation and the Romanian Dietary Guidelines recommends that adults should aim to consume approximately 25–30 g fiber daily. Dietary fiber is found in the indigestible parts of cereals, fruits and vegetables. There are countries where people don’t eat enough food fibers, these people need to take some kind of fiber supplement. Evidence has been found that dietary fiber from whole foods or supplements may (1) reduce the risk of cardiovascular disease by improving serum lipids and reducing serum total and low-density lipoprotein (LDL) cholesterol concentrations, (2) decreases the glycaemic index of foods, which leads to an improvement in glycemic response, positive impact on diabetes, (3) protect against development of obesity by increasing satiety hormone leptin concentrations, (4) reduced risk of developing colorectal cancer by normalizes bowel movements, improve the integrity of the epithelial layer of the intestines, increase the resistance against pathogenic colonization, have favorable effects on the gut microbiome, wich is the second genomes of the microorganisms, (5) have a positive impact on the endocrine system by gastrointestinal polypeptide hormonal regulation of digestion, (6) have prebiotic effect by short-chain fatty acids (SCFA) production; butyrate acid is the preferred energy source for colonic epithelial cells, promotes normal cell differentiation and proliferation, and also help regulate sodium and water absorption, and can enhance absorption of calcium and other minerals. Although all prebiotics are fiber, not all fiber is prebiotic. This generally refers to the ability of a fiber to increase the growth of bifidobacteria and lactobacilli, which are beneficial to human health, and (7) play a role in improving immune function via production of SCFAs by increases T helper cells, macrophages, neutrophils, and increased cytotoxic activity of natural killer cells. Conclusion: Fiber consumption is associated with high nutritional value and antioxidant status of the diet, enhancing the effects on human health. Fibers with prebiotic properties can also be recommended as part of fiber intake. Due to the variability of fiber’s effects in the body, it is important to consume fiber from a variety of sources. Increasing fiber consumption for health promotion and disease prevention is a critical public health goal.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Because CD4(+) T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4(+) T cells could enhance an antitumor response mediated by similarly gene-engineered CD8(+) T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4(+) and CD8(+) cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4(+) and CD8(+) T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2(+) tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8(+) and CD4(+) T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8(+)) engineered T cells. Transferred CD4(+) T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent re-challenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8(+) and CD4(+) T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Periodontal disease is a chronic inflammation of the attachment structures of the teeth, triggered by potentially hazardous microorganisms and the consequent immune-inflammatory responses. In humans, the T helper type 17 (Th17) lineage, characterized by interleukin-17 (IL-17) production, develops under transforming growth factor-beta (TGF-beta), IL-1 beta, and IL-6 signaling, while its pool is maintained by IL-23. Although this subset of cells has been implicated in various autoimmune, inflammatory, and bone-destructive conditions, the exact role of T lymphocytes in chronic periodontitis is still controversial. Therefore, in this study we investigated the presence of Th17 cells in human periodontal disease. Gingival and alveolar bone samples from healthy patients and patients with chronic periodontitis were collected and used for the subsequent assays. The messenger RNA expression for the cytokines IL-17, TGF-beta, IL-1 beta, IL-6, and IL-23 in gingiva or IL-17 and receptor activator for nuclear factor-kappa B ligand in alveolar bone was evaluated by real-time polymerase chain reaction. The production of IL-17, TGF-beta, IL-1 beta, IL-6, and IL-23 proteins was evaluated by immunohistochemistry and the presence of Th17 cells in the inflamed gingiva was confirmed by immunofluorescence confocal microscopy for CD4 and IL-17 colocalization. Our data demonstrated elevated levels of IL-17, TGF-beta, IL-1 beta, IL-6, and IL-23 messenger RNA and protein in diseased tissues as well as the presence of Th17 cells in gingiva from patients with periodontitis. Moreover, IL-17 and the bone resorption factor RANKL were abundantly expressed in the alveolar bone of diseased patients, in contrast to low detection in controls. These results provided strong evidence for the presence of Th17 cells in the sites of chronic inflammation in human periodontal disease.