Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Overexpression of DR-nm23, a protein encoded by a member of the nm23 gene family, inhibits granulocyte differentiation and induces apoptosis in 32Dc13 myeloid cells.

Chronic myelogenous leukemia evolves in two clinically distinct stages: a chronic and a blast crisis phase. The molecular changes associated with chronic phase to blast crisis transition are largely unknown. We have identified a cDNA clone, DR-nm23, differentially expressed in a blast-crisis cDNA library, which has approximately 70% sequence similarity to the putative metastatic suppressor genes, nm23-H1 and nm23-H2. The deduced amino acid sequence similarity to the proteins encoded by these two latter genes is approximately 65% and includes domains and amino acid residues (the leucine zipper-like and the RGD domain, a serine and a histidine residue in the NH2- and in the COOH-terminal portion of the protein, respectively) postulated to be important for nm23 function. DR-nm23 mRNA is preferentially expressed at early stages of myeloid differentiation of highly purified CD34+ cells. Its constitutive expression in the myeloid precursor 32Dc13 cell line, which is growth-factor dependent for both proliferation and differentiation, results in inhibition of granulocytic differentiation induced by granulocyte colony-stimulating factor and causes apoptotic cell death. These results are consistent with a role for DR-nm23 in normal hematopoiesis and raise the possibility that its overexpression contributes to differentiation arrest, a feature of blastic transformation in chronic myelogenous leukemia.

Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H(+)-ATPase.

Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.

Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Donor pretreatment with progenipoietin-1 is superior to granulocyte colony-stimulating factor in preventing graft-versus-host disease after allogeneic stem cell transplantation

The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function

Granulocyte-colony stimulating factor increases CD123hi blood dendritic cells with altered CD62L and CCR7 expression

Changes in blood dendritic cell (BDC) counts (CD123(hi)BDC and CD11c(+)BDC) and expression of CD62L, CCR7, and CD49d were analyzed in healthy donors, multiple myeloma (MM), and non-Hodgkin lymphoma (NHL) patients, who received granulocyte-colony stimulating factor (G-CSF) containing peripheral blood stem cell (PBSC) mobilization protocols. Low-dose G-CSF in healthy donors (8-10 mug/ kg/d subcutaneously) and high-dose G-CSF in patients (30 mug/kg/d) increased CD123(hi)BDC (2- to 22-fold, mean 3.7 x 10(6)/ L-17.7 x 10(6)/L and 1.9 x 10(6)/L-12.0 x 10(6)/ L) in healthy donors and MM but decreased CD11c(+)BDC (2- to 10-fold, mean 5.7 x 10(6)/L-1.6 x 10(6)/L) in NHL patients, on the day of apheresis, compared with steady state. After apheresis, CD123(hi)BDC counts remained high, whereas low CD11c(+)BDC counts tended to recover in the following 2-5 days. Down-regulation of CD62L and up-regulation of CCR7 on CD123(hi)BDC were found in most healthy donors and MM patients. CD49d expression was unchanged. Thus, PBSC mobilization may change BDC counts by altering molecules necessary for BDC homing from blood into tissues.

Granulocyte colony-stimulating factor modulates alpha-galactosylceramide-responsive human V alpha 24(+) V beta 11(+) NKT cells

Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.

Chronic graft-versus-host disease after granulocyte colony-stimulating factor-mobilized allogeneic stem cell transplantation: The role of donor T-cell dose and differentiation

The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.

Transcription factor Tfec contributes to the IL-4-inducible expression of a small group of genes in mouse macrophages including the granulocyte colony-stimulating factor receptor

Expression of the mouse transcription factor EC (Tfec) is restricted to the myeloid compartment, suggesting a function for Tfec in the development or function of these cells. However, mice lacking Tfec develop normally, indicating a redundant role for Tfec in myeloid cell development. We now report that Tfec is specifically induced in bone marrow-derived macrophages upon stimulation with the Th2 cytokines, IL-4 and IL-13, or LPS. LPS induced a rapid and transient up-regulation of Tfec mRNA expression and promoter activity, which was dependent on a functional NF-kappa B site. IL-4, however, induced a rapid, but long-lasting, increase in Tfec mRNA, which, in contrast to LPS stimulation, also resulted in detectable levels of Tfec protein. IL-4-induced transcription of Tfec was absent in macrophages lacking Stat6, and its promoter depended on two functional Stat6-binding sites. A global comparison of IL-4-induced genes in both wild-type and Tfec mutant macrophages revealed a surprisingly mild phenotype with only a few genes affected by Tfec deficiency. These included the G-CSFR (Csf3r) gene that was strongly up-regulated by IL-4 in wild-type macrophages and, to a lesser extent, in Tfec mutant macrophages. Our study also provides a general definition of the transcriptome in alternatively activated mouse macrophages and identifies a large number of novel genes characterizing this cell type.

Granulocyte-colony-stimulating factor mobilizes bone marrow stem cells in patients with subacute ischemic stroke: the Stem Cell Trial of Recovery EnhanceMent After Stroke (STEMS) Pilot Randomized, Controlled Trial (ISRCTN 16784092)

Background and Purpose - Loss of motor function is common after stroke and leads to significant chronic disability. Stem cells are capable of self-renewal and of differentiating into multiple cell types, including neurones, glia, and vascular cells. We assessed the safety of granulocyte-colony-stimulating factor (G-CSF) after stroke and its effect on circulating CD34 stem cells. Methods - We performed a 2-center, dose-escalation, double-blind, randomized, placebo-controlled pilot trial (ISRCTN 16784092) of G-CSF (6 blocks of 1 to 10 g/kg SC, 1 or 5 daily doses) in 36 patients with recent ischemic stroke. Circulating CD34 stem cells were measured by flow cytometry; blood counts and measures of safety and functional outcome were also monitored. All measures were made blinded to treatment. Results - Thirty-six patients, whose mean SD age was 768 years and of whom 50% were male, were recruited. G-CSF (5 days of 10 g/kg) increased CD34 count in a dose-dependent manner, from 2.5 to 37.7 at day 5 (area under curve, P0.005). A dose-dependent rise in white cell count (P0.001) was also seen. There was no difference between treatment groups in the number of patients with serious adverse events: G-CSF, 7/24 (29%) versus placebo 3/12 (25%), or in their dependence (modified Rankin Scale, median 4, interquartile range, 3 to 5) at 90 days. Conclusions - ”G-CSF is effective at mobilizing bone marrow CD34 stem cells in patients with recent ischemic stroke. Administration is feasible and appears to be safe and well tolerated. The fate of mobilized cells and their effect on functional outcome remain to be determined. (Stroke. 2006;37:2979-2983.)

Granulocyte-colony stimulating factor in experimental stroke and its effects on infarct size and functional outcome: a systematic review

Background Granulocyte-colony stimulating factor (G-CSF) shows promise as a treatment for stroke. This systematic review assesses G-CSF in experimental ischaemic stroke. Methods Relevant studies were identified with searches of Medline, Embase and PubMed. Data were extracted on stroke lesion size, neurological outcome and quality, and analysed using Cochrane Review Manager using random effects models; results are expressed as standardised mean difference (SMD) and odds ratio (OR). Results Data were included from 19 publications incorporating 666 animals. G-CSF reduced lesion size significantly in transient (SMD -1.63, p<0.00001) but not permanent (SMD -1.56, p=0.11) focal models of ischaemia. Lesion size was reduced at all doses and with treatment commenced within 4 hours of transient ischaemia. Neurological deficit (SMD -1.37, p=0.0004) and limb placement (SMD -1.88, p=0.003) improved with G-CSF; however, locomotor activity (>4 weeks post ischaemia) was not (SMD 0.76, p=0.35). Death (OR 0.27, p<0.0001) was reduced with G-CSF. Median study quality was 4 (range 0-7/8); Egger’s test suggested significant publication bias (p=0.001). Conclusions G-CSF significantly reduced lesion size in transient but not permanent models of ischaemic stroke. Motor impairment and death were also reduced. Further studies assessing dose-response, administration time, length of ischaemia and long-term functional recovery are needed.