Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

A novel interferon-gamma regulated human melanoma-associated antigen, gp33-38, defined by monoclonal antibody Me14-D12. II. Molecular cloning of a genomic probe.

The human Me14-D12 antigen is a cell surface glycoprotein regulated by interferon-gamma (IFN-gamma) on tumor cell lines of neuroectodermal origin. It consists of two non-convalently linked subunits with apparent mol. wt sizes of 33,000 and 38,000. Here we describe the molecular cloning of a genomic probe for the Me14-D12 gene using the gene transfer approach. Mouse Ltk- cells were stably cotransfected with human genomic DNA and the Herpes Simplex virus thymidine kinase (TK) gene. Primary and secondary transfectants expressing the Me14-D12 antigen were isolated after selection in HAT medium by repeated sorting on a fluorescence activated cell sorter (FACS). A recombinant phage harboring a 14.3 kb insert of human DNA was isolated from a genomic library made from a positive secondary transfectant cell line. A specific probe derived from the phage DNA insert allowed the identification of two mRNAs of 3.5 kb and 2.2 kb in primary and secondary L cell transfectants, as well as in human melanoma cell lines expressing the Me14-D12 antigen. The regulation of Me14-D12 antigen by INF-gamma was retained in the L cell transfectants and could be detected both at the level of protein and mRNA expression.

Simple method for detection of MYH11 DNA rearrangements in patients with inv(16)(p13q22) and acute myeloid leukemia.

The pericentric inversion on chromosome 16 [inv(16)(p13q22)] and related t(16;16)(p13;q22) are recurrent aberrations associated with acute myeloid leukemia (AML) M4 Eo. Both abberations result in a fusion of the core binding factor beta (CBFB) and smooth muscle myosin heavy chain gene (MYH11). A selected genomic 6.9-kb BamHl probe detects MYH11 DNA rearrangements in 18 of 19 inv(16)/t(16;16) patients tested using HindIII digested DNA. The rearranged fragments were not detectable after remission in two cases tested, while they were present after relapse in one of these two cases tested.

Meta-analysis of estrogen response in MCF-7 distinguishes early target genes involved in signaling and cell proliferation from later target genes involved in cell cycle and DNA repair.

ABSTRACT: BACKGROUND: Many studies have been published outlining the global effects of 17 beta-estradiol (E2) on gene expression in human epithelial breast cancer derived MCF-7 cells. These studies show large variation in results, reporting between ~100 and ~1500 genes regulated by E2, with poor overlap. RESULTS: We performed a meta-analysis of these expression studies, using the Rank product method to obtain a more accurate and stable list of the differentially expressed genes, and of pathways regulated by E2. We analyzed 9 time-series data sets, concentrating on response at 3-4 hrs (early) and at 24 hrs (late). We found >1000 statistically significant probe sets after correction for multiple testing at 3-4 hrs, and >2000 significant probe sets at 24 hrs. Differentially expressed genes were examined by pathway analysis. This revealed 15 early response pathways, mostly related to cell signaling and proliferation, and 20 late response pathways, mostly related to breast cancer, cell division, DNA repair and recombination. CONCLUSIONS: Our results show that meta-analysis identified more differentially expressed genes than the individual studies, and that these genes act together in networks. These results provide new insight into E2 regulated mechanisms, especially in the context of breast cancer.

Typing Candida albicans oral isolates from human immunodeficiency virus-infected patients by multilocus enzyme electrophoresis and DNA fingerprinting.

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Bending modes of DNA directly addressed by cryo-electron microscopy of DNA minicircles.

We use cryo-electron microscopy (cryo-EM) to study the 3D shapes of 94-bp-long DNA minicircles and address the question of whether cyclization of such short DNA molecules necessitates the formation of sharp, localized kinks in DNA or whether the necessary bending can be redistributed and accomplished within the limits of the elastic, standard model of DNA flexibility. By comparing the shapes of covalently closed, nicked and gapped DNA minicircles, we conclude that 94-bp-long covalently closed and nicked DNA minicircles do not show sharp kinks while gapped DNA molecules, containing very flexible single-stranded regions, do show sharp kinks. We corroborate the results of cryo-EM studies by using Bal31 nuclease to probe for the existence of kinks in 94-bp-long minicircles.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

DNA Topoisomerase I Gene Copy Number and mRNA Expression Assessed as Predictive Biomarkers for Adjuvant Irinotecan in Stage II/III Colon Cancer.

PURPOSE: Prospective-retrospective assessment of theTOP1gene copy number andTOP1mRNA expression as predictive biomarkers for adjuvant irinotecan in stage II/III colon cancer. EXPERIMENTAL DESIGN: Formalin-fixed, paraffin-embedded tissue microarrays were obtained from an adjuvant colon cancer trial (PETACC3) where patients were randomized to 5-fluorouracil/folinic acid with or without additional irinotecan.TOP1copy number status was analyzed by fluorescencein situhybridization (FISH) using aTOP1/CEN20 dual-probe combination.TOP1mRNA data were available from previous analyses. RESULTS: TOP1FISH and follow-up data were obtained from 534 patients.TOP1gain was identified in 27% using a single-probe enumeration strategy (≥4TOP1signals per cell) and in 31% when defined by aTOP1/CEN20 ratio ≥ 1.5. The effect of additional irinotecan was not dependent onTOP1FISH status.TOP1mRNA data were available from 580 patients with stage III disease. Benefit of irinotecan was restricted to patients characterized byTOP1mRNA expression ≥ third quartile (RFS: HRadjusted, 0.59;P= 0.09; OS: HRadjusted, 0.44;P= 0.03). The treatment byTOP1mRNA interaction was not statistically significant, but in exploratory multivariable fractional polynomial interaction analysis, increasingTOP1mRNA values appeared to be associated with increasing benefit of irinotecan. CONCLUSIONS: In contrast to theTOP1copy number, a trend was demonstrated for a predictive property ofTOP1mRNA expression. On the basis ofTOP1mRNA, it might be possible to identify a subgroup of patients where an irinotecan doublet is a clinically relevant option in the adjuvant setting of colon cancer.Clin Cancer Res; 22(7); 1621-31. ©2015 AACR.

Genotyping of group A rotavirus samples from Brazilian children by probe hybridization

The G genotyping of 74 group A rotavirus samples was done by RNA-DNA hybridization (dot-blot) using oligonucleotide probes for the VP7 gene region of the human rotavirus serotypes/genotypes 1, 2, 3 and 4. Thirty-one samples could be genotyped by dot-blot showing the following results: G1 = 16, G4 = 6, G3 = 5, and G2 = 4. The data show circulation of genotypes G1-G4 and the predominance of G1. The knowledge of genotypes provides important information concerning rotavirus circulation in Central Brazil.

Intracellular antioxidant and DNA repair enzymes as correlates of stress resistance and longevity in vertebrates

In animals, both stress resistance and longevity appear to be influenced by the insulin/insulin-like growth factor-l signaling (lIS) pathway, the basic organization of which is highly conserved from invertebrates to vertebrates. Reduced lIS or genetic disruption of the lIS pathway leads to the activation of forkhead box transcription factors, which is thought to upregulate the expression of genes involved in enhancing stress resistance, including perhaps key antioxidant enzymes as well as DNA repair enzymes. Enhanced antioxidant and DNA repair capacities may underlie the enhanced cellular stress resistance observed in long-lived animals, however little data is available that directly supports this idea. I used three. experimental approaches to test the association of intracellular antioxidant and DNA base excision repair (BER) capacities with stress resistance and longevity: (1) a comparison of multiple vertebrate endotherm species of varying body masses and longevities; (2) a comparison of long-lived Snell dwarf mice and their normallittermates; and (3) a comparison of hypometabolic animals undergoing hibernation or estivation with their active counterparts. The activities of the five major intracellular antioxidant enzymes as well as the two rate-limiting enzymes in the BER pathway, apurininc/apyrimidinic (AP) endonuclease and polymerase ~, were measured. These measurements were performed in one or more of the following: (1) cultured dermal fibroblasts; (2) brain tissue; (3) heart tissue; (4) liver tissue. My results indicate that antioxidant enzymes are not universally upregulated in association with enhanced stress resistance and longevity. I also did not find that BER enzyme activity was positively correlated with longevity, in an inter-species context, though there was evidence for enhanced BER in long-lived Snell dwarf mice. Thus, while there were instances in which enhanced antioxidant and BER enzyme activities were associated with increased stress resistance and/or longevity, this was not universally the case, indicating that other mechanisms must be involved. These results suggest the need to re-examine existing 'oxidative stress' hypotheses of longevity and probe further into the molecular physiology of longevity to discover its mechanistic basis.

Adrenergic and serotonergic function in dna synthesis during rat liver regeneration and in hepatocyte cultures

The adult mammalian liver is predominantly in a quiescent state with respect to cell division. This quiescent state changes dramatically, however, if the liver is injured by toxic, infectious or mechanic agents (Ponder, 1996). Partial hepatectomy (PH) which consists of surgical removal of two-thirds of the liver, has been used to stimulate hepatocyte proliferation (Higgins & Anderson 1931). This experimental model of liver regeneration has been the target of many studies to probe the mechanisms responsible for liver cell growth control (Michalopoulos, 1990; Taub, 1996). After PH most of the remaining cells in the renmant liver respond with co-ordinated waves of DNA synthesis and divide in a process called compensatory hyperplasia. Hence, liver regeneration is a model of relatively synchronous cell cycle progression in vivo. In contrast to hepatomas, cell division is terminated under some intrinsic control when the original cellular mass has been regained. This has made liver regeneration a useful model to dissect the biochemical and molecular mechanisms of cell division regulation. The liver is thus, one of the few adult organs that demonstrates a physiological growth rewonse (Fausto & Mead, 1989; Fausto & Webber, 1994). The regulation of liver cell proliferation involves circulating or intrahepatic factors that are involved in either the priming of hepatocytes to enter the cell cycle (Go to G1) or progression through the cell cycle. In order to understand the basis of liver regeneration it is mandatory to define the mechanisms which (a) trigger division, (b) allow the liver to concurrently grow and maintain dilferentiated fimction and (c) terminate cell proliferation once the liver has reached the appropriate mass. Studies on these aspects of liver regeneration will provide basic insight of cell growth and dilferentiation, liver diseases like viral hepatitis, toxic damage and liver transplant where regeneration of the liver is essential. In the present study, Go/G1/S transition of hepatocytes re-entering the cell cycle after PH was studied with special emphasis on the involvement of neurotransmitters, their receptors and second messenger function in the control of cell division during liver regeneration

Modified rare earth semiconductor oxide as a new nucleotide probe

Recent rapid developments in biological analysis, medical diagnosis, pharmaceutical industry, and environmental control fuel the urgent need for recognition of particular DNA sequences from samples. Currently, DNA detection techniques use radiochemical, enzymatic, fluorescent, or electrochemiluminescent methods; however, these techniques require costly labeled DNA and highly skilled and cumbersome procedure, which prohibit any in-situ monitoring. Here, we report that hybridization of surface-immobilized single-stranded oligonucleotide on praseodymium oxide (evaluated as a biosensor surface for the first time) with complimentary strands in solution provokes a significant shift of electrical impedance curve. This shift is attributed to a change in electrical characteristics through modification of surface charge of the underlying modified praseodymium oxide upon hybridization with the complementary oligonucelotide strand. On the other hand, using a noncomplementary single strand in solution does not create an equivalent change in the impedance value. This result clearly suggests that a new and simple electrochemical technique based on the change in electrical properties of the modified praseodymium oxide semiconductor surface upon recognition and transduction of a biological event without using labeled species is revealed.

Detection of Chlamydia psittaci DNA in avian clinical samples by polymerase chain reaction

A polymerase chain reaction (PCR) assay was developed to detect Chlamydia psittaci DNA in faeces and tissue samples from avian species. Primers were designed to amplify a 264 bp product derived from part of the 5' non-translated region and part of the coding region of the ompA gene which encodes the major outer membrane protein. Amplified sequences were confirmed by Southern hybridization using an internal probe. The sensitivity of the combined assay was found to be between 60 to 600 fg of chlamydial DNA (approximately 6 to 60 genome copies). The specificity of the assay was confirmed since PCR product was not obtained from samples containing several serotypes of C. trachomatis, strains of C. pneumoniae, the type strain of C. pecorum, nor from samples containing microorganisms commonly found in the avian gut flora. In this study, 404 avian faeces and 141 avian tissue samples received by the Central Veterinary Laboratory over a 6 month period were analysed by PCR, antigen detection ELISA and where possible, cell culture isolation. PCR performed favourably compared with ELISA and cell culture, or with ELISA alone. The PCR assay was especially suited to the detection of C. psittaci DNA in avian faeces samples. The test was also useful when applied to tissue samples from small contact birds associated with a case of human psittacosis where ELISA results were negative and chlamydial isolation was a less favourable method due to the need for rapid diagnosis.

Direct observation by time-resolved infrared spectroscopy of the bright and the dark excited states of the [Ru(phen)2(dppz)]2+ light-switch compound in solution and when bound to DNA

The [Ru(phen)2(dppz)]2+ complex (1) is non-emissive in water but is highly luminescent in organic solvents or when bound to DNA, making it a useful probe for DNA binding. To date, a complete mechanistic explanation for this “light-switch” effect is still lacking. With this in mind we have undertaken an ultrafast time resolved infrared (TRIR) study of 1 and directly observe marker bands between 1280–1450 cm-1, which characterise both the emissive “bright” and the non-emissive “dark” excited states of the complex, in CD3CN and D2O respectively. These characteristic spectral features are present in the [Ru(dppz)3]2+ solvent light-switch complex but absent in [Ru(phen)3]2+, which is luminescent in both solvents. DFT calculations show that the vibrational modes responsible for these characteristic bands are predominantly localised on the dppz ligand. Moreover, they reveal that certain vibrational modes of the “dark” excited state couple with vibrational modes of two coordinating water molecules, and through these to the bulk solvent, thus providing a new insight into the mechanism of the light-switch effect. We also demonstrate that the marker bands for the “bright” state are observed for both L- and D enantiomers of 1 when bound to DNA and that photo-excitation of the complex induces perturbation of the guanine and cytosine carbonyl bands. This perturbation is shown to be stronger for the L enantiomer, demonstrating the different binding site properties of the two enantiomers and the ability of this technique to determine the identity and nature of the binding site of such intercalators.

Confinement-induced phase transition in a DNA-lipid hydrated complex

We study the effect of the soft confinement by fluid lipid bilayers on the spatial organisation of DNA molecules in a DNA-zwitterionic lipid hydrated lamellar complex. The confinement is increased by dehydrating the complex in a controlled way, which leads to a decrease of the water channel thickness separating the periodically stacked bilayers. Using grazing-incidence small-angle X-ray scattering on an oriented thin film, we probe in situ as dehydration proceeds the structure of the DNA-lipid complex. A structural phase transition is evidenced, where an apparently disordered phase of DNA rods embedded within the one-dimensionally ordered lipid lamellar phase observed at high hydration is replaced by a 2D hexagonal structure of DNA molecules intercalated between the lipid bilayers. Copyright (C) EPLA, 2010