Obtenção de uma nova proteína recombinante componente do complexo telemérico LAGT1 de Leishmania Amazonensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Synthese und Charakterisierung von multivalenten kationischen Tensiden und Polymeren

Der Einsatz von den Polyelektrolytkomplexen von DNA / RNA mit Polykationen oder Lipiden in der Gen-Therapie ist für Wissenschaftler von besonderem Interesse, da sie als Träger für den Transport von genetischem Material in lebende Zellen fungieren können. Interessant ist auch die Komplexbildung aus Gadolinium und Polykation, hier können die stabil gebildeten Aggregate als Kontrastmittel zur Anwendung in der Magnetresonanztomographie eingeführt werden. Ziel der vorliegenden Arbeit war es, strukturdefinierte, positiv geladene, polyvalente sperminanaloge Polymere zu synthetisieren. Durch die polyelektrolytische Natur erlauben solche Polymere die Komplexierung von mehr Gadolinium-Polyoxometalaten und wären deshalb sehr gut als Kontrastmittel geeignet. Aufbauend auf den Vorarbeiten, wurde insbesondere die Komplexbildung von kationischem Polymer mit der Green Fluorescent Protein DNA in physiologischem Salzgehalt untersucht. Die Beschreibung der Synthese im Rahmen dieser Arbeit zeigt, dass es mit dem entwickelten Syntheseprinzip, also unter Einsatz von orthogonaler Schutzgruppenchemie und funktionaler Transformation gelungen ist, durch einfache nukleophile Substitution die Kopplung der Elementareinheiten zu komplexeren, auch ionischen Tensiden durchzuführen. Die Komplexierung von Gadolinium-Polyoxometalat mit kationisch geladenem Polymer in reinem Wasser und in physiologischem Salzgehalt hat gezeigt, dass bei einem Ladungsverhältnis von ungefähr 2:1 stabile sphärische Komplexe gebildet werden. HeLa-Zellen zeigen keine hohe Empfindlichkeit gegenüber Polykation-POM-Komplexen, da deren toxische Wirkung nur einen Anteil toter Zellen von maximal 24 % zur Folge hatte. Die Bildqualität einer MRT-Aufnahme der gebildeten Polykation-POM-Komplexe wurde im Vergleich zu den reinen Gadolinium-Polyoxometalat-Lösungen erheblich verbessert. Die Komplexierung von DNA mit dem im Überschuss vorliegenden kationisch geladenen Polymer wurde mittels Rasterkraftmikroskopie, statischer sowie dynamischer Lichtstreuung untersucht. Die Molmasse und Größe der Polykation-DNA-Komplexe geben eindeutige Hinweise darauf, dass sich in physiologischer Salzlösung Multi-Ketten-Komplexe bilden. Neben der Untersuchung der Polymer-Komplexe wurde eine Reihe neuartiger multivalenter kationischer Tenside hergestellt, wobei ihre Eigenschaften beispielsweise mit Tensid B (C12N4), Tensid C (EG8N4) und Tensid F (EG8C12N4) in wässriger Lösung bei verschiedener Salzkonzentration im Vordergrund stehen.

Funktionelle HPMA-Copolymere zur möglichen Anwendung in der Tumor-Immuntherapie

Der Fokus dieser Arbeit lag in der Synthese von funktionellen HPMA-Copolymeren, sowohl für die Darstellung definierter Polymer-Antikörper Konjugate, als auch zum effizienten Transport von p-DNA in Polymer-DNA Komplexen (Polyplexe). Nach ausführlicher physikalischer und chemischer Charakterisierung wurden gezielt ihre Wechselwirkungen mit (Immun)-Zellen untersucht und so ihr Potential für die Verwendung in der Tumor-Immuntherapie aufgezeigt.rnFür das gezielte Ansprechen von bestimmten Immunzellen mit Schlüsselfunktionen besitzen monoklonale Antikörper ein großes Potential. Im Rahmen dieser Arbeit gelang die Darstellung definierter Polymer-Antikörper Konjugate über das gezielte Einführen von Thiol-Gruppen an Antikörper und die Synthese eng verteilter, Maleinimid funktionalisierter HPMA-Copolymere. Diese sehr gut definierten, funktionellen HPMA-Copolymere konnten über die Kombination der RAFT-Polymerisation und Reaktivester Polymeren gewonnen werden. Unterschiedliche Polymerstrukturen ermöglichten die Synthese verschiedener Arten von Polymer-Antikörper Konjugaten. Speziell die Untersuchung der verschiedenen Konjugate aus dem für dendritische Zellen spezifischen aDEC-205 Antikörper an Immunzellen aus dem Knochenmark von Mäusen lieferten wertvolle Erkenntnisse über Struktur-Wirkungsbeziehungen und zeigten die Möglichkeit der gezielten Adressierung von Immunzellen mit Schlüsselfunktionen bei der Aktivierung einer (Tumor)-Immunabwehr am Beispiel von dendritischen Zellen. Gleichzeitig erlaubt der Syntheseweg sowohl die gleichzeitige und kontrollierte Einführung auch komplexerer Stimuli am Polymerrückgrat als auch die Verwendung verschiedener Antikörper.rnÜber die Kombination der RAFT-Polymerisation und polymeren Reaktivestern wurde ebenso die Synthese von neuartigen kationisch-hydrophilen Polylysin-b-poly(HPMA) Blockcopolymeren als effiziente Transporter für den komplexen aber wirkungsvollen Wirkstoff p-DNA in Form von Polymer-DNA Komplexen (Polyplexe) realisiert. Da diese Polyplexe gleichzeitig eine Abschirmung der sensitiven p-DNA über eine poly(HPMA)-Korona vermitteln, stellen sie allgemein ein geeignetes Transportmittel für einen therapeutischen Transport von p-DNA dar. Diese Polyplexe sind in der Lage, humane Nierenkarzinomzellen (HEK-293T Zelllinie) zu transfizieren ohne signifikante Zytotoxizität zu zeigen. Darüber hinaus gelang eine große Steigerung der Transfektionseffizienz, ohne eine gleichzeitige Erhöhung der Zytotoxizität, durch die gezielte Einführung von Redox-stimuliresponsiven Disulfid-Gruppen zwischen den einzelnen Blöcken. Diese Polyplexe stellen einen polymeren Vektor zur transkriptionellen Regulierung von Zellen dar, zum Beispiel für die transkriptionelle Aktivierung von dendritischen Zellen, durch die Verwendung speziell dafür modifizierter p-DNA-Konstrukte. rnDurch die Verknüpfung einer ortsspezifischen enzymatischen Kopplung und kupferfreien Cyclooctin-Azid Kupplung gelang die kontrollierte und kovalente Modifizierung von polymeren Mizellen mit aDEC-205 Antikörpern an der hydrophilen poly(HPMA)-Korona. Diese Methode bietet die Möglichkeit der Anbindung der effektiven aber anspruchsvollen Erkennungsstruktur Antikörper an komplexere Polymerstrukturen und andere nano-partikulären Systeme, zum Beispiel an die zuvor genannten Polyplexe, um eine zellspezifische und verbesserte Aufnahme und Prozessierung zu erreichen.rnDiese Studien zeigen somit, sowohl die Möglichkeit der selektiven Addressierung von Immunzellen mit Schlüsselfunktionen wie dendritischer Zellen, als auch die Möglichkeit der transkriptionellen Regulation von Zellen durch Polyplexe. Sie stellen somit einen ersten Schritt zur Herstellung funktioneller, nanopartikulärer Systeme zur Verwendung in der Tumor-Immuntherapie dar. rn

Water-soluble fullerene (C60) derivatives as nonviral gene-delivery vectors.

A new class of water-soluble C60 transfecting agents has been prepared using Hirsch-Bingel chemistry and assessed for their ability to act as gene-delivery vectors in vitro. In an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the C60 vectors in gene delivery and expression, several different C60 derivatives were synthesized to yield either positively charged, negatively charged, or neutral chemical functionalities under physiological conditions. These fullerene derivatives were then tested for their ability to transfect cells grown in culture with DNA carrying the green fluorescent protein (GFP) reporter gene. Statistically significant expression of GFP was observed for all forms of the C60 derivatives when used as DNA vectors and compared to the ability of naked DNA alone to transfect cells. However, efficient in vitro transfection was only achieved with the two positively charged C60 derivatives, namely, an octa-amino derivatized C60 and a dodeca-amino derivatized C60 vector. All C60 vectors showed an increase in toxicity in a dose-dependent manner. Increased levels of cellular toxicity were observed for positively charged C60 vectors relative to the negatively charged and neutral vectors. Structural analyses using dynamic light scattering and optical microscopy offered further insights into possible correlations between the various derivatized C60 compounds, the C60 vector/DNA complexes, their physical attributes (aggregation, charge) and their transfection efficiencies. Recently, similar Gd@C60-based compounds have demonstrated potential as advanced contrast agents for magnetic resonance imaging (MRI). Thus, the successful demonstration of intracellular DNA uptake, intracellular transport, and gene expression from DNA using C60 vectors suggests the possibility of developing analogous Gd@C60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

Porcine cathelicidins efficiently complex and deliver nucleic acids to plasmacytoid dendritic cells and can thereby mediate bacteria-induced IFN-α responses.

Cathelicidins constitute potent antimicrobial peptides characterized by a high cationic charge that enables strong interactions with nucleic acids. In fact, the only human cathelicidin LL-37 triggers rapid sensing of nucleic acids by plasmacytoid dendritic cells (pDC). Among the porcine cathelicidins, phylogenetic analysis of the C-terminal mature peptide showed that porcine myeloid antimicrobial peptide (PMAP)-36 was the most closely related of the 11 porcine cathelicidins to human LL-37. Despite several investigations evaluating potent antimicrobial functions of porcine cathelicidins, nothing is known about their ability to promote pDC activation. We therefore investigated the capacity of the proline-arginine-rich 39-aa peptide, PMAP-23, PMAP-36, and protegrin-1 to complex with bacterial DNA or synthetic RNA molecules and facilitate pDC activation. We demonstrate that these peptides mediate a rapid and efficient uptake of nucleic acids within minutes, followed by robust IFN-α responses. The highest positively charged cathelicidin, PMAP-36, was found to be the most potent peptide tested for this effect. The peptide-DNA complexes were internalized and also found to associate with the cell membranes of pDC. The amphipathic conformation typical of PMAP-36 was not required for IFN-α induction in pDC. We also demonstrate that PMAP-36 can mediate IFN-α induction in pDC stimulated by Escherichia coli, which alone fail to activate pDC. This response was weaker with a scrambled PMAP-36, relating to its lower antimicrobial activity. Collectively, our data suggest that the antimicrobial and nucleic acid-complexing properties of cathelicidins can mediate pDC activation-promoting adaptive immune responses against microbial infections.

Mechanisms of HER2/{\it neu\/} proto-oncogene overexpression in breast cancer cells

Overexpression and amplification of HER2/neu have been documented in many primary tumors, most notably in breast. Not only do approximately 30% of breast cancer patients carry tumors that overexpress the gene, but those that do generally have shorter overall and disease-free survival times than patients with tumors expressing low levels of HER2/neu. Thus, overexpression of HER2/neu plays an important role in the pathogenesis of breast cancer. We have examined the mechanisms that result in HER2/neu overexpression in breast cancer by using, as a model system, established breast cancer cell lines that express much higher levels of HER2/neu mRNA than normal breast tissue while maintaining a near normal HER2/neu gene copy number. Nuclear run-on experiments indicate that the breast cancer cell lines MDA-MB453, BT483, and BT474 have an increased HER2/neu gene transcription rate. By using HER2/neu promoter-CAT constructs, we have found that the enhanced HER2/neu transcription rate in MDA-MB453 cells is due to activation of the gene in trans, while the enhanced transcription rate in BT483 cells is due to activation of the gene in either trans or cis. In BT474 cells, transcriptional upregulation is primarily due to gene amplification. Since the levels of increased transcription are not as high as the levels of HER2/neu mRNA in any of these three lines, post-transcriptional deregulation that increases HER2/neu expression must also be functioning in these cells. The half-life of HER2/neu mRNA was measured and found to be equivalent in these lines as in a control. Thus, the post-transcriptional deregulation is not increased stability of the HER2/neu transcript.^ Much work has been performed in characterizing the altered trans-acting factor involved in increased HER2/neu transcription in MDA-MB453 cells. Using promoter deletion constructs linked to a reporter gene, the region responsive to this factor was localized in the rat neu promoter. When human HER2/neu promoter constructs were used, the homologous sequence in the human promoter was identified. Furthermore, a number of protein/DNA complexes are detected when these promoter regions are used in gel mobility shift assays. UV-crosslinking experiments indicate DNA-binding proteins of roughly 110 kDa, 70 kDa, and 35 kDa are capable of interacting with the human promoter element. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Protein–RNA interactions: a structural analysis

A detailed computational analysis of 32 protein–RNA complexes is presented. A number of physical and chemical properties of the intermolecular interfaces are calculated and compared with those observed in protein–double-stranded DNA and protein–single-stranded DNA complexes. The interface properties of the protein–RNA complexes reveal the diverse nature of the binding sites. van der Waals contacts played a more prevalent role than hydrogen bond contacts, and preferential binding to guanine and uracil was observed. The positively charged residue, arginine, and the single aromatic residues, phenylalanine and tyrosine, all played key roles in the RNA binding sites. A comparison between protein–RNA and protein–DNA complexes showed that whilst base and backbone contacts (both hydrogen bonding and van der Waals) were observed with equal frequency in the protein–RNA complexes, backbone contacts were more dominant in the protein–DNA complexes. Although similar modes of secondary structure interactions have been observed in RNA and DNA binding proteins, the current analysis emphasises the differences that exist between the two types of nucleic acid binding protein at the atomic contact level.

Receptor-mediated gene transfer into macrophages.

Gene transfer systems targeting various receptors have been developed to introduce functional genes into cells in culture and into intact animals. A synthetic molecular conjugate, consisting of mannosylated polylysine that exploits endocytosis via the macrophage mannose receptor, was constructed and complexed to expression plasmids containing either the Photinus pyralis luciferase or Escherichia coli beta-galactosidase (lacZ) reporter genes. The DNA complexes were used to transfect murine macrophages isolated from peritoneal exudates in vitro. Luciferase and beta-galactosidase activity was found in transfected cells in culture, whereas complexes consisting of an irrelevant plasmid bound to mannosylated polylysine or the expression plasmid bound to galactosylated polylysine resulted in no detectable transgene expression. Gene transfer was inhibited by the addition of excess mannosylated bovine serum albumin to the culture medium before transfection. Reporter genes were also transferred into macrophages residing in the spleen and liver of adult animals using this system. Luciferase activity was maximal at 4 days after transfection and decreased to lower levels by 16 days. Transgene expression conformed to the distribution of cells that had nonspecific esterase, a cytochemical marker for macrophages. Thus, this system can be used to introduce functional genes into macrophages and may be an approach to the treatment of storage diseases that affect the reticuloendothelial system.

In vitro integration of human immunodeficiency virus type 1 cDNA into targets containing protein-induced bends.

Integration of human immunodeficiency virus type 1 cDNA into a target DNA can be strongly influenced by the conformation of the target. For example, integration in vitro is sometimes favored in target DNAs containing sequence-directed bends or DNA distortions caused by bound proteins. We have analyzed the effect of DNA bending by studying integration into two well-characterized protein-DNA complexes: Escherichia coli integration host factor (IHF) protein bound to a phage IHF site, and the DNA binding domain of human lymphoid enhancer factor (LEF) bound to a LEF site. Both of these proteins have previously been reported to bend DNA by approximately 140 degrees. Binding of IHF greatly increases the efficiency of in vitro integration at hotspots within the IHF site. We analyzed a series of mutants in which the IHF site was modified at the most prominent hotspot. We found that each variant still displayed enhanced integration upon IHF binding. Evidently the local sequence is not critical for formation of an IHF hotspot. LEF binding did not create preferred sites for integration. The different effects of IHF and LEF binding can be rationalized in terms of the different proposed conformations of the two protein-DNA complexes.

A model for the transcriptional regulation of the CYP2B1/B2 gene in rat liver.

The phenobarbitone-responsive minimal promoter has been shown to lie between nt -179 and nt + 1 in the 5' (upstream) region of the CYP2B1/B2 gene in rat liver, on the basis of the drug responsiveness of the sequence linked to human growth hormone gene as reporter and targeted to liver as an asialoglycoprotein-DNA complex in vivo. Competition analyses of the nuclear protein-DNA complexes formed in gel shift assays with the positive (nt -69 to -98) and negative (nt -126 to -160) cis elements (PE and NE, respectively) identified within this region earlier indicate that the same protein may be binding to both the elements. The protein species purified on PE and NE affinity columns appear to be identical based on SDS/PAGE analysis, where it migrates as a protein of 26-28 kDa. Traces of a high molecular weight protein (94-100 kDa) are also seen in the preparation obtained after one round of affinity chromatography. The purified protein stimulates transcription of a minigene construct containing the 179 nt on the 5' side of the CYP2B1/B2 gene linked to the I exon in a cell-free system from liver nuclei. The purified protein can give rise to all the three complexes (I, II, and III) with the PE, just as the crude nuclear extract, under appropriate conditions. Manipulations in vitro indicate that the NE has a significantly higher affinity for the dephosphorylated form than for the phosphorylated form of the protein. The PE binds both forms. Phenobarbitone treatment of the animal leads to a significant increase in the phosphorylation of the 26- to 28-kDa and 94-kDa proteins in nuclear labeling experiments followed by isolation on a PE affinity column. We propose that the protein binding predominantly to the NE in the dephosphorylated state characterizes the basal level of transcription of the CYP2B1/B2 gene. Phenobarbitone treatment leads to phosphorylation of the protein, shifting the equilibrium toward binding to the PE. This can promote interaction with an upstream enhancer through other proteins such as the 94-kDa protein and leads to a significant activation of transcription.

Transcriptional activation of human adult alpha-globin genes by hypersensitive site-40 enhancer: function of nuclear factor-binding motifs occupied in erythroid cells.

The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element.

The hepatitis B virus X protein targets the basic region-leucine zipper domain of CREB.

The X gene product encoded by the hepatitis B virus, termed pX, is a promiscuous transactivator of a variety of viral and cellular genes under the control of diverse cis-acting elements. Although pX does not appear to directly bind DNA, pX-responsive elements include the NF-kappa B, AP-1, and CRE (cAMP response element) sites. Direct protein-protein interactions occur between viral pX and the CRE-binding transcription factors CREB and ATF. Here we examine the mechanism of the protein-protein interactions occurring between CREB and pX by using recombinant proteins and in vitro DNA-binding assays. We demonstrate that pX interacts with the basic region-leucine zipper domain of CREB but not with the DNA-binding domain of the yeast transactivator protein Gal4. The interaction between CREB and pX increases the affinity of CREB for the CRE site by an order of magnitude, although pX does not alter the rate of CREB dimerization. Methylation interference footprinting reveals differences between the CREB DNA and CREB-pX DNA complexes. These experiments demonstrate that pX titers the way CREB interacts with the CRE DNA and suggest that the basic, DNA-binding region of CREB is the target of pX. Transfection assays in PC12 cells with the CREB-dependent somatostatin promoter demonstrate a nearly 15-fold transcriptional induction after forskolin stimulation in the presence of pX. These results support the significance of the CREB-pX protein-protein interactions in vivo.

Lipoplexes formulation and optimisation:in vitro transfection studies reveal no correlation with in vivo vaccination studies

The aim of these studies was to compare the effect of liposome composition on physico-chemical characteristics and transfection efficacy of cationic liposomes both in vitro and in vivo. Comparison between 4 popularly used cationic lipids, showed 3b-N-(dimethylaminoethyl)carbamate (DC-Chol) to promote the highest transfect levels in cells in vitro with levels being at least 6 times higher than those of 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA). 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and dimethyldioctadecylammonium (DDA) and approximately twice as efficient as dipalmitoyl-trimethylammonium-propane (DPTAP). To establish the role of the helper lipid, DC-Chol liposomes were formulated in combination with either 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE) or cholesterol (Chol) (1:1 molar ratio) with and without the addition of phosphatidyl choline. The choice of helper lipid incorporated within the bilayer was found to influence the formation of complexes, their resultant structure and their transfection efficiency in vitro, with SUV-DNA complexes containing optimum levels of DOPE giving higher transfection than those containing cholesterol. The inclusion of PC within the formulation also reduced transfection efficiency in vitro. However, when administered in vivo, SUV-DNA complexes composed of PC:Chol:DC-Chol at a molar ratio of 16:8:4 micromole/ml were the most effective at inducing splenocyte proliferation upon exposure to antigen in comparison to control spleens. These results demonstrate that there is no in vitro/in vivo correlation between the transfection efficacy of these liposome formulations and in vitro transfection in the above cell model cannot be taken as a reliable indicator for in vivo efficacy of DNA vaccines.