968 resultados para Colony-stimulating factor


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Changes in blood dendritic cell (BDC) counts (CD123(hi)BDC and CD11c(+)BDC) and expression of CD62L, CCR7, and CD49d were analyzed in healthy donors, multiple myeloma (MM), and non-Hodgkin lymphoma (NHL) patients, who received granulocyte-colony stimulating factor (G-CSF) containing peripheral blood stem cell (PBSC) mobilization protocols. Low-dose G-CSF in healthy donors (8-10 mug/ kg/d subcutaneously) and high-dose G-CSF in patients (30 mug/kg/d) increased CD123(hi)BDC (2- to 22-fold, mean 3.7 x 10(6)/ L-17.7 x 10(6)/L and 1.9 x 10(6)/L-12.0 x 10(6)/ L) in healthy donors and MM but decreased CD11c(+)BDC (2- to 10-fold, mean 5.7 x 10(6)/L-1.6 x 10(6)/L) in NHL patients, on the day of apheresis, compared with steady state. After apheresis, CD123(hi)BDC counts remained high, whereas low CD11c(+)BDC counts tended to recover in the following 2-5 days. Down-regulation of CD62L and up-regulation of CCR7 on CD123(hi)BDC were found in most healthy donors and MM patients. CD49d expression was unchanged. Thus, PBSC mobilization may change BDC counts by altering molecules necessary for BDC homing from blood into tissues.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Expression of the mouse transcription factor EC (Tfec) is restricted to the myeloid compartment, suggesting a function for Tfec in the development or function of these cells. However, mice lacking Tfec develop normally, indicating a redundant role for Tfec in myeloid cell development. We now report that Tfec is specifically induced in bone marrow-derived macrophages upon stimulation with the Th2 cytokines, IL-4 and IL-13, or LPS. LPS induced a rapid and transient up-regulation of Tfec mRNA expression and promoter activity, which was dependent on a functional NF-kappa B site. IL-4, however, induced a rapid, but long-lasting, increase in Tfec mRNA, which, in contrast to LPS stimulation, also resulted in detectable levels of Tfec protein. IL-4-induced transcription of Tfec was absent in macrophages lacking Stat6, and its promoter depended on two functional Stat6-binding sites. A global comparison of IL-4-induced genes in both wild-type and Tfec mutant macrophages revealed a surprisingly mild phenotype with only a few genes affected by Tfec deficiency. These included the G-CSFR (Csf3r) gene that was strongly up-regulated by IL-4 in wild-type macrophages and, to a lesser extent, in Tfec mutant macrophages. Our study also provides a general definition of the transcriptome in alternatively activated mouse macrophages and identifies a large number of novel genes characterizing this cell type.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The lineage of dendritic cells (DC), and in particular their relationship to monocytes and macrophages, remains obscure. Furthermore, the requirement for the macrophage growth factor CSF-1 during DC homeostasis is unclear. Using a transgenic mouse in which the promoter for the CSF-1R (c-fms) directs the expression of enhanced GFP in cells of the myeloid lineage, we determined that although the c-fms promoter is inactive in DC precursors, it is up-regulated in all DC subsets during differentiation. Furthermore, plasmacytoid DC and all CD11c(high) DC subsets are reduced by 50-70% in CSF-1-deficient osteopetrotic mice, confirming that CSF-1 signaling is required for the optimal differentiation of DC in vivo. These data provide additional evidence that the majority of tissue DC is of myeloid origin during steady state and supports a close relationship between DC and macrophage biology in vivo.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background and Purpose - Loss of motor function is common after stroke and leads to significant chronic disability. Stem cells are capable of self-renewal and of differentiating into multiple cell types, including neurones, glia, and vascular cells. We assessed the safety of granulocyte-colony-stimulating factor (G-CSF) after stroke and its effect on circulating CD34 stem cells. Methods - We performed a 2-center, dose-escalation, double-blind, randomized, placebo-controlled pilot trial (ISRCTN 16784092) of G-CSF (6 blocks of 1 to 10 g/kg SC, 1 or 5 daily doses) in 36 patients with recent ischemic stroke. Circulating CD34 stem cells were measured by flow cytometry; blood counts and measures of safety and functional outcome were also monitored. All measures were made blinded to treatment. Results - Thirty-six patients, whose mean SD age was 768 years and of whom 50% were male, were recruited. G-CSF (5 days of 10 g/kg) increased CD34 count in a dose-dependent manner, from 2.5 to 37.7 at day 5 (area under curve, P0.005). A dose-dependent rise in white cell count (P0.001) was also seen. There was no difference between treatment groups in the number of patients with serious adverse events: G-CSF, 7/24 (29%) versus placebo 3/12 (25%), or in their dependence (modified Rankin Scale, median 4, interquartile range, 3 to 5) at 90 days. Conclusions - ”G-CSF is effective at mobilizing bone marrow CD34 stem cells in patients with recent ischemic stroke. Administration is feasible and appears to be safe and well tolerated. The fate of mobilized cells and their effect on functional outcome remain to be determined. (Stroke. 2006;37:2979-2983.)