982 resultados para Colony-Stimulating Factors
Resumo:
In previous studies we showed that 5 days of treatment with granulocyte colony-stimulating factor (G-CSF) and stem cell factor (SCF) mobilized murine repopulating cells to the peripheral blood (PB) and that these cells could be efficiently transduced with retroviral vectors. We also found that, 7-14 days after cytokine treatment, the repopulating ability of murine bone marrow (BM) increased 10-fold. In this study we examined the efficiency of gene transfer into cytokine-primed murine BM cells and extended our observations to a nonhuman primate autologous transplantation model. G-CSF/SCF-primed murine BM cells collected 7-14 days after cytokine treatment were equivalent to post-5-fluorouracil BM or G-CSF/SCF-mobilized PB cells as targets for retroviral gene transfer. In nonhuman primates, CD34-enriched PB cells collected after 5 days of G-CSF/SCF treatment and CD34-enriched BM cells collected 14 days later were superior targets for retroviral gene transfer. When a clinically approved supernatant infection protocol with low-titer vector preparations was used, monkeys had up to 5% of circulating cells containing the vector for up to a year after transplantation. This relatively high level of gene transfer was confirmed by Southern blot analysis. Engraftment after transplantation using primed BM cells was more rapid than that using steady-state bone marrow, and the fraction of BM cells saving the most primitive CD34+/CD38- or CD34+/CD38dim phenotype increased 3-fold. We conclude that cytokine priming with G-CSF/SCF may allow collection of increased numbers of primitive cells from both the PB and BM that have improved susceptibility to retroviral transduction, with many potential applications in hematopoietic stem cell-directed gene therapy.
Resumo:
AML1 is involved in the (8;21) translocation, associated with acute myelogenous leukemia (AML)-type M2, which results in the production of the AML1-ETO fusion protein: the amino-terminal 177 amino acids of AML1 and the carboxyl-terminal 575 amino acids of ETO. The mechanism by which AML1-ETO accomplishes leukemic transformation is unknown; however, AML1-ETO interferes with AML1 transactivation of such AML1 targets as the T-cell receptor beta enhancer and the granulocyte-macrophage colony-stimulating factor promoter. Herein, we explored the effect of AML1-ETO on regulation of a myeloid-specific AML1 target, the macrophage colony-stimulating factor (M-CSF) receptor promoter. We found that AML1-ETO and AML1 work synergistically to transactivate the M-CSF receptor promoter, thus exhibiting a different activity than previously described. Truncation mutants within the ETO portion of AML1-ETO revealed the region of ETO necessary for the cooperativity between AML1 and AML1-ETO lies between amino acids 347 and 540. Endogenous M-CSF receptor expression was examined in Kasumi-1 cells, derived from a patient with AML-M2 t(8;21) and the promonocytic cell line U937. Kasumi-1 cells exhibited a significantly higher level of M-CSF receptor expression than U937 cells. Bone marrow from patients with AML-M2 t(8;21) also exhibited a higher level of expression of M-CSF receptor compared with normal controls. The upregulation of M-CSF receptor expression by AML1-ETO may contribute to the development of a leukemic state in these patients.
Resumo:
The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.
Resumo:
We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.
Resumo:
The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.
Resumo:
To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.
Resumo:
Neutrophils in tissue culture spontaneously undergo programmed cell death (apoptosis), a process characterized by well-defined morphological alterations affecting the cell nucleus. We found that these morphological changes were preceded by intracellular acidification and that acidification and the apoptotic changes in nuclear morphology were both delayed by granulocyte colony-stimulating factor (G-CSF). Among the agents that defend neutrophils against intracellular acidification is a vacuolar H(+)-ATPase that pumps protons out of the cytosol. When this proton pump was inhibited by bafilomycin A1, G-CSF no longer protected the neutrophils against apoptosis. We conclude that G-CSF delays apoptosis in neutrophils by up-regulating the cells' vacuolar H(+)-ATPase and that intracellular acidification is an early event in the apoptosis program.
Resumo:
Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.
Resumo:
We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The granulocyte colony-stimulating factor (G-CSF) and Fit-3 receptor agonist progenipoietin-1 (ProGP-1) has potent effects on dendritic cell (DC) expansion and may be an alternative to G-CSF for the mobilization of stem cells for allogeneic stem cell transplantation (SCT). We studied the ability of stem cell grafts mobilized with this agent to induce graft-versus-host disease (GVHD) to minor and major histocompatibility antigens in the well-described B6 --> B6D2F1 SCT model. ProGP-1, G-CSIF, or control diluent was administered to donor B6 mice. ProGP-1 expanded all cell lineages in the spleen, and unseparated splenocytes from these animals produced large amounts of interleukin 10 (IL-10) and transforming growth factor beta (TGFbeta) whereas the expression of T-cell adhesion molecules was diminished. Transplantation survival was 0%, 50%, and 90% in recipients of control-, G-CSF-, and ProGP-1-treated allogeneic donor splenocytes, respectively (P < .0001). Donor pretreatment with ProGP-1 allowed a 4-fold escalation in T-cell dose over that possible with G-CSF. Donor CD4 T cells from allogeneic SCT recipients of ProGP-1 splenocytes demonstrated an anergic response to host antigen, and cytokine production (interferon gamma [IFNγ], IL-4, and IL-10) was also reduced while CD8 T-cell cytotoxicity to host antigens remained intact. Neither CD11c(hi) DCs nor CD11c(dim)/B220(hi) DCs from ProGP-1-treated animals conferred protection from GVHD when added to control spleen. Conversely, when equal numbers of purified T cells from control-, G-CSF-, or ProGP-1-treated allogeneic donors were added to allogeneic T-cell-depleted control spleen, survival at day 60 was 0%, 15%, and 90%, respectively (P < .0001). The improved survival in recipients of ProGP-1 T cells was associated with reductions in systemic tumor necrosis factor alpha generation and GVHD of the gastrointestinal tract. We conclude that donor pretreatment with ProGP-1 is superior to G-CSIF for the prevention of GVHD after allogeneic SCT, primarily due to incremental affects on T-cell phenotype and function
Resumo:
Changes in blood dendritic cell (BDC) counts (CD123(hi)BDC and CD11c(+)BDC) and expression of CD62L, CCR7, and CD49d were analyzed in healthy donors, multiple myeloma (MM), and non-Hodgkin lymphoma (NHL) patients, who received granulocyte-colony stimulating factor (G-CSF) containing peripheral blood stem cell (PBSC) mobilization protocols. Low-dose G-CSF in healthy donors (8-10 mug/ kg/d subcutaneously) and high-dose G-CSF in patients (30 mug/kg/d) increased CD123(hi)BDC (2- to 22-fold, mean 3.7 x 10(6)/ L-17.7 x 10(6)/L and 1.9 x 10(6)/L-12.0 x 10(6)/ L) in healthy donors and MM but decreased CD11c(+)BDC (2- to 10-fold, mean 5.7 x 10(6)/L-1.6 x 10(6)/L) in NHL patients, on the day of apheresis, compared with steady state. After apheresis, CD123(hi)BDC counts remained high, whereas low CD11c(+)BDC counts tended to recover in the following 2-5 days. Down-regulation of CD62L and up-regulation of CCR7 on CD123(hi)BDC were found in most healthy donors and MM patients. CD49d expression was unchanged. Thus, PBSC mobilization may change BDC counts by altering molecules necessary for BDC homing from blood into tissues.
Resumo:
The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.
Resumo:
Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.
Resumo:
The use of granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood as a source of stem cells has resulted in a high incidence of severe chronic graft-versus-host disease (cGVHD), which compromises the outcome of clinical allogeneic stem cell transplantation. We have studied the effect of G-CSF on both immune complex and fibrotic cGVHD directed to major (DBA/2 --> B6D2F1) or minor (B10.D2 --> BALB/c) histocompatibility antigens. In both models, donor pretreatment with G-CSF reduced cGVHD mortality in association with type 2 differentiation. However, after escalation of the donor T-cell dose, scleroderma occurred in 90% of the recipients of grafts from G-CSF-treated donors. In contrast, only 11% of the recipients of control grafts developed scleroderma, and the severity of hepatic cGVHD was also reduced. Mixing studies confirmed that in the presence of high donor T-cell doses, the severity of scleroderma was determined by the non-T-cell fraction of grafts from G-CSF-treated donors. These data confirm that the induction of cGVHD after donor treatment with G-CSF is dependent on the transfer of large numbers of donor T cells in conjunction with a putatively expanded myeloid lineage, providing a further rationale for the limitation of cell dose in allogeneic stem cell transplantation. (C) 2004 American Society for Blood and Marrow Transplantation.