244 resultados para Brucella abortus
Resumo:
The characterization of proteins from Brucella spp, the causative agent of brucellosis, has been the subject of intensive research. We have described an 18-kDa cytoplasmic protein of Brucella abortus and shown the potential usefulness of this protein as an antigen for the serologic diagnosis of brucellosis. The amino acid sequence of the protein showed a low but significant homology with that of lumazine synthases. Lumazine is an intermediate product in bacterial riboflavin biosynthesis. The recombinant form of the 18-kDa protein (expressed in E. coli) folds like the native Brucella protein and has lumazine-synthase enzymatic activity. Three-dimensional analysis by X-ray crystallography of the homolog Bacillus subtilis lumazine synthase has revealed that the enzyme forms an icosahedral capsid. Recombinant lumazine synthase from B. abortus was crystallized, diffracted X rays to 2.7-Å resolution at room temperature, and the structure successfully solved by molecular replacement procedures. The macromolecular assembly of the enzyme differs from that of the enzyme from B. subtilis. The Brucella enzyme remains pentameric (90 kDa) in its crystallographic form. Nonetheless, the active sites of the two enzymes are virtually identical at the structural level, indicating that inhibitors of these enzymes could be viable pharmaceuticals across a broad species range. We describe the structural reasons for the differences in their quaternary arrangement and also discuss the potential use of this protein as a target for the development of acellular vaccines.
Resumo:
Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.
Resumo:
The aim was to study the seroprevalence of Toxoplasma gondii in water buffaloes (Bubalus bubalis) from State of Pará, Brazil. Three hundred and nineteen buffaloes were randomly selected into seven municipalities of Marajó Island. For comparative purposes, 128 buffaloes of five municipalities in the state of Pará were also evaluated. The seroprevalence of T. gondii was evaluated by Indirect Enzyme Linked Immunosorbent Assay (iELISA). The samples diagnosed as positive in iELISA were subjected to Immunofluorescence Antibody Test (IFAT). We evaluated risk factors: location, breed, pregnancy and co-infection with Brucella abortus or Mycobacterium bovis. The frequency of animals positive for T. gondii in iELISA were compared by chi-square (x2) with 95% confidence. Variables with p <0.2 were subjected to logistic regression analysis; the model was built based on the odds ratios test. The prevalence of T. gondii in iELISA was 41,6% (186/447). In IFAT, 86,5% (161/186) had their positivity for T. gondii confirmed. The average prevalence in the municipalities of the Marajó Island and of the mainland was 32% (103/319) and 55% (70/128), respectively. The municipalities with the highest prevalence were Soure (53%) and Salvaterra (49%) in Marajó Island, and Castanhal (55%) and Thailândia (50%) in the Continent. The breed and co-infection with Brucella abortus or Mycobacterium bovis presented no influence on the prevalence of T. gondii. Additionally, pregnant animals were 57% more positive for T. gondii than nonpregnant animals. The presence of antibodies is an indicative of T. gondii in buffaloes in the state of Pará, and these findings represent a risk not only for farm animals, but to public health as a source of infection.
Resumo:
Pós-graduação em Doenças Tropicais - FMB
Resumo:
O objetivo do estudo foi conhecer a prevalência sorológica de Toxoplasma gondii em búfalos (Bubalus bubalis) do Estado do Pará, Brasil. Foram selecionados randomicamente 319 bubalinos distribuídos em sete municípios da Ilha do Marajó. Para efeito comparativo também foram avaliados 128 bubalinos pertencentes a cinco municípios do Estado do Pará. A prevalência sorológica de Toxoplasma gondii foi avaliada pelo Ensaio de Imunoadsorção Enzimático Indireto (iELISA). As amostras diagnósticadas como positivas no iELISA foram submetidas a Reação de Imunofluorescência Indireta (RIFI). Foram avaliados os fatores de risco: localidade, raça, gestação, co-infecção por Brucella abortus e co-infecção por Mycobacterium bovis. As frequências de animais positivos no iELISA para T. gondii foram comparadas pelo teste de Qui-quadrado (χ2) com 95% de confiabilidade. As variáveis com p<0,2 foram submetidos à análise de regressão logística, sendo o modelo construído baseado no teste da "odds ratios". A prevalência de T. gondii observada no iELISA foi de 41,6% (186/447). Na RIFI, 86,5% (161/186) das amostram positivas no iELISA tiveram sua positividade para T. gondii confirmada. A prevalência média nos municípios da Ilha do Marajo e do Continente foi de 32% (103/319) e 55% (70/128), respectivamente. Os municípios que apresentaram as maiores prevalências foram Soure (53%) e Salvaterra (49%) na Ilha do Marajó e Castanhal (55%) e Tailândia (50%) no Continente. Os fatores de risco raça e co-infecção por Brucella abortus ou Mycobacterium bovis não influenciaram na prevalência de T. gondii. Além disso, animais gestantes foram 57% mais positivos para T. gondii do que animais não gestantes. A circulação de anticorpos é um indicativo da presença do agente da toxoplasmose em búfalos no Estado do Pará. Esses achados representam um risco não apenas para os animais de produção, mas à saúde pública, como uma fonte de infecção.
Resumo:
O objetivo do trabalho foi a detecção de anticorpos anti - Brucella abortus e anti – Leptospira interrogans em soros de eqüídeos e seus tratadores nos bairros das cidades de Belém e Ananindeua, abrangendo os meses de abril a agosto de 2005, utilizando para este fim, 195 soros sanguíneos de eqüídeos e 70 soros sanguíneos de homens que manipulavam os animais direta ou indiretamente. Para a pesquisa de animais sororeagentes à B. abortus, foram usadas as provas do Antígeno Acidificado Tamponado (AAT) como teste de triagem e a Soro Aglutinação Lenta em Tubos (SAL) e o teste do 2-Mercaptoetanol (2-ME), como teste confirmatórios. Para a Leptospirose, foi utilizada a prova de Soroaglutinação Microscópica (SAM), sendo realizada a triagem dos soros frente à 25 sorovares de L. interrogans, considerando-se positivos aquelas amostras com titulação igual ou maior que 100. De 195 amostras de soros sanguíneos de eqüídeos, 184 (94,87%) foram positivas para todos os sorovares analisados, sendo que os mais frequentemente encontrados foram: Patoc, Automnalis, Ictehaemohragiae, Pyrogenes e Bratislava. Para as amostras sanguíneas de homens, a positividade foi de 49 (70%) de soros reagentes, com os sorovares Patoc, Ictehaemohragiae, Bratislava, Butembo, Copenhageni e Automnalis os mais detectados. Das amostras positivas de animais e seus respectivos tratadores, 47/70 (67,14%) foram semelhantes para os mesmos sorovares de Leptospira spp., sendo que 2/70 (2,86%) amostras foram negativas em ambos os grupos pesquisados, 2/70 (2,86%) foram somente positivas em homens e 19/70 (27,14%) foram exclusivamente positivas nas amostras de soros de eqüídeos. Os bairros do Coqueiro, Guamá, 40 horas, Barreiro e Bengui apresentaram a maior percentagem de casos soropositivos. Não houve diferença significativa em relação às outras variantes estudadas, como: idade (animal e homem), tempo de serviço (animal e homem), espécie do animal, escore corporal do animal e grau de instrução do homem. Tanto nos animais quanto nos homens não foram detectadas reações positivas para B. abortus.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
A utilização de novas tecnologias empregando a biologia molecular busca superar os principais problemas encontrados nas vacinas atualmente comercializadas no combate à brucelose bovina. Desta forma, a identificação de proteínas imunogênicas e a posterior transformação dos genes correspondentes em micro-organismos competentes tem sido um dos principais alvos para o desenvolvimento de novas formas de controle da infecção. O presente trabalho tem como objetivo propor, em base teórica, uma vacina de eficácia e segurança superiores às encontradas atualmente no mercado contra a brucelose bovina, antropozoonose contagiosa provocada principalmente pela espécie Brucella abortus. Essa enfermidade produz infecção característica em bovinos e bubalinos e é infecciosa ao homem, causando doença crônica que leva à incapacidade parcial ou total para o trabalho. Por ter distribuição universal, acarreta problemas sanitário e de saúde pública importantes e grandes prejuízos econômicos. A vacina proposta visa o desenvolvimento de microorganismos transformados contendo genes de proteínas de potencial imunológico que, após purificação, são usadas para o combate da doença. As proteínas recombinantes abordadas no presente estudo são as proteína ribossomal L7/L12 e a lumazina sintetase que, ao serem utilizadas em uma vacina subcelular, diferente das comercializadas atualmente, induzem resposta de longa duração, não induzem a produção de anticorpos que interfiram no diagnóstico e não são patogênicas ao homem.
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
The aim of this study was to study the seroepidemiological profile of brucellosis and leptospirosis in horses traction Island Maiandeua, state of Para. In two distinct periods, blood samples were collected from 52 animals of both sexes and different ages (2 to 17 years), totaling 104 samples. For the research of antibodies anti-Brucella abortus were used in rapid agglutination test in plate. In the first harvest, none animal was positive, however in the second harvest there were three animals reactive serum. The research of antibodies anti-Leptospira spp. was performed with the use of the microscopic agglutination test (MAT), the first harvest was 23.07% reacting animals and 15.38% at the second harvest, for one or more Leptospira spp. with titers ranging from 100 to 200. The predominant serotype at first and second harvest was the Autumnalis 40% and 37.5% respectively. According to age, it was observed in group 1 (2 to 7 years) 27.78% and 13.89% respectively in the two samples and the second group (> 7 years) was found 12.50% and 18 75% of reactive serum. The results observed in this study demonstrated that the island of Maiandeua, state of Para, there is the presence of Leptospira spp, with the most frequent serovar autumnalis and possible exposure of animals to brucella smooth, suggesting low risk of infection in the population of horses examined.
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
The objective of the present study was to compare the performance of three serological tests for diagnosis of Brucella abortus infections in buffaloes (Bubalus bubalis). Serum samples collected from 696 adult females were submitted to the competitive enzyme-linked immunosorbent assay (ELISAC), (I-ELISA), fluorescence polarization test (FPA), 2-mercaptoethanol test (2-ME) and complement fixation test (CFT). The gold standard was the combination of CFT and 2-ME, considering as positive the reactors in both CFT and 2-ME, and as negative those non-reactors. ROC analyses were done for C-ELISA, I-ELISA and FPA and the Kappa agreement index were also calculated. The best combinations of relative sensitivity (SEr) and relative specificity (SPr) and Kappa were given by C-ELISA (96.9%, 99.1%, and 0.932, respectively) and FPA (92.2%, 97.6 and 0.836, respectively). The C-ELISA and FPA were the most promising confirmatory tests for the serological diagnosis of brucellosis in buffaloes, and for these tests, cut-off values for buffaloes may be the same as those used for bovines.
Resumo:
The complete genome sequence of Caulobacter crescentus was determined to be 4,016,942 base pairs in a single circular chromosome encoding 3,767 genes. This organism, which grows in a dilute aquatic environment, coordinates the cell division cycle and multiple cell differentiation events. With the annotated genome sequence, a full description of the genetic network that controls bacterial differentiation, cell growth, and cell cycle progression is within reach. Two-component signal transduction proteins are known to play a significant role in cell cycle progression. Genome analysis revealed that the C. crescentus genome encodes a significantly higher number of these signaling proteins (105) than any bacterial genome sequenced thus far. Another regulatory mechanism involved in cell cycle progression is DNA methylation. The occurrence of the recognition sequence for an essential DNA methylating enzyme that is required for cell cycle regulation is severely limited and shows a bias to intergenic regions. The genome contains multiple clusters of genes encoding proteins essential for survival in a nutrient poor habitat. Included are those involved in chemotaxis, outer membrane channel function, degradation of aromatic ring compounds, and the breakdown of plant-derived carbon sources, in addition to many extracytoplasmic function sigma factors, providing the organism with the ability to respond to a wide range of environmental fluctuations. C. crescentus is, to our knowledge, the first free-living α-class proteobacterium to be sequenced and will serve as a foundation for exploring the biology of this group of bacteria, which includes the obligate endosymbiont and human pathogen Rickettsia prowazekii, the plant pathogen Agrobacterium tumefaciens, and the bovine and human pathogen Brucella abortus.
Resumo:
A general strategy for the expression of bacterial membrane transport and receptor genes in Escherichia coli is described. Expression is amplified so that the encoded proteins comprise 5-35% of E. coli inner membrane protein. Depending upon their topology, proteins are produced with RGSH6 or a Strep tag at the C-terminus. These enable purification in mg quantities for crystallization and NMR studies. Examples of one nutrient uptake and one multidrug extrusion protein from Helicobacter pylori are described. This strategy is successful for membrane proteins from H. pylori, E. coli, Enterococcus faecalis, Bacillus subtilis, Staphylococcus aureus, Microbacterium liquefaciens, Brucella abortus, Brucella melitensis, Campylobacter jejuni, Neisseria meningitides, Streptomyces coelicolor and Rhodobacter sphaeroides. ©2005 Biochemical Society.