987 resultados para Biology, Molecular|Biology, Cell|Chemistry, Biochemistry


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Diabetes mellitus (DM) is a disease that affects a large number of people, and the number of problems associated with the disease has been increasing in the past few decades. These problems include cardiovascular disorders, blindness and the eventual need to amputate limbs. Therefore, the quality of life for people living with DM is less than it is for healthy people. In several cases, metabolic syndrome (MS), which can be considered a disturbance of the lipid metabolism, is associated with DM. In this work, two drugs used to treat DM, pioglitazone and rosiglitazone, were studied using theoretical methods, and their molecular properties were related to the biological activity of these drugs. From the results, it was possible to correlate the properties of each substance-particularly electronic properties-with the biological interactions that are linked to their pharmacological effects. These results suggest that there are future prospects for designing or developing new drugs based on the correlation between theoretical and experimental properties.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fatty acid (FA) may disturb the redox state of the cells not only by an increase in reactive oxygen species (ROS) generation but also due to a reduction in antioxidant enzyme activities. The effect of various FAs (palmitic, stearic, oleic, linoleic, gamma-linolenic and eicosapentaenoic acids (EPAs)) on Jurkat and Raji cells, (human T and B leukaemic cell lines was investigated). The following measurements were carried out: FA composition of the cells, cell proliferation and activities of catalase, glutathione peroxidase (GPx) and superoxide dismutase (SOD). The protective effect of alpha-tocopherol on cell death was also investigated. Each cell line presented a specific FA composition. All the tested ENS reduced catalase activity. The toxic effect of FA was abolished by the pre-incubation with physiological concentrations of alpha-tocopherol. The findings support the proposition that the increase in oxidative stress induced by FA partially occurs due to a reduction in catalase activity. In spite of the decrease in the enzyme activity, catalase protein and mRNA levels were not changed, suggesting a post-translational regulation. Copyright (C) 2007 John Wiley & Sons, Ltd.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

During rat hepatocarcinogenesis preneoplastic lesions (PNL) emerge which may persist (pPNL) and be sites of progress to cancer or suffer remodeling (rPNL) tending to disappear. Cellular and molecular mechanisms involved in both phenotypes are not sufficiently elucidated. pPNL and rPNL cellular proliferation and apoptosis were evaluated in rats submitted to the resistant hepatocyte (RH) model, and an adjusted growth index (AGI) was established. p53, Bcl-2, and NF-kappa B p65 subunit expression was evaluated by immunohistochemistry in pPNL and rPNL. p65 expression and NF-kappa B activation was evaluated by Western blot assays in whole livers. A lower number of BrdU-stained hepatocyte nuclei/mm(2) and higher number of apoptotic bodies (AB) per mm(2) were observed in remodeling compared to pPNL. Cytoplasmic p53 accumulation is related to increased hepatocarcinoma malignancy. We observed that 71.3% pPNL and 25.4% rPNL (P < 0.05) presented p53 staining in the cytoplasm. Similarly, 67.7% pPNL and 23.1 % rPNL (P < 0.05) presented increased Bcl-2 staining. Thirty-two percent pPNL and 15.6% rPNL (P < 0.05) presented p65 staining. Compared to normal rats, increase (P < 0.05) of hepatic p65 expression and NF-kappa B activation in rats submitted to the RH model was observed. in agreement to previous studies hepatic pPNL and rPNL differ regarding cell proliferation and apoptosis. Moreover, persistence and remodeling involve differences in p53, Bcl-2, and NF-kappa B pathways. These data point to molecular pathways that may direct preneoplastic lesions to spontaneously regress or to progress to cancer.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Histamine is an important biogenic amine, which acts with a group of four G-protein coupled receptors (GPCRs), namely H(1) to H(4) (H(1)R - H(4)R) receptors. The actions of histamine at H(4)R are related to immunological and inflammatory processes, particularly in pathophysiology of asthma, and H(4)R ligands having antagonistic properties could be helpful as antiinflammatory agents. In this work, molecular modeling and QSAR studies of a set of 30 compounds, indole and benzimidazole derivatives, as H(4)R antagonists were performed. The QSAR models were built and optimized using a genetic algorithm function and partial least squares regression (WOLF 5.5 program). The best QSAR model constructed with training set (N = 25) presented the following statistical measures: r (2) = 0.76, q (2) = 0.62, LOF = 0.15, and LSE = 0.07, and was validated using the LNO and y-randomization techniques. Four of five compounds of test set were well predicted by the selected QSAR model, which presented an external prediction power of 80%. These findings can be quite useful to aid the designing of new anti-H(4) compounds with improved biological response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Nitric oxide (NO) plays an important role in the control of the vascular tone and the most often employed NO donors have limitations due to their harmful side-effects. In this context, new NO donors have been prepared, in order to minimize such undesirable effects. cis-[Ru(bpy)(2)(py)NO(2)](PF(6)) (RuBPY) is a new nitrite complex synthesized in our laboratory that releases NO in the presence of the vascular tissue only. In this work the vasorelaxation induced by this NO donor has been studied and compared to that obtained with the well known NO donor SNP. The relaxation induced by RuBPY is concentration-dependent in denuded rat aortas pre-contracted with phenylephrine (EC(50)). This new compound induced relaxation with efficacy similar to that of SNP, although its potency is lower. The time elapsed until maximum relaxation is achieved (E(max) = 240 s) is similar to measured for SNP (210 s). Vascular reactivity experiments demonstrated that aortic relaxation by RuBPY is inhibited by the soluble guanylyl-cyclase inhibitor 1H-[1,2,4] oxadiozolo[4,3-a]quinoxaline-1-one (ODQ 1 mu M). In a similar way, 1 mu M ODQ also reduces NO release from the complex as measured with DAF-2 DA by confocal microscopy. These findings suggest that this new complex RuBPY that has nitrite in its structure releases NO inside the vascular smooth muscle cell. This ruthenium complex releases significant amounts of NO only in the presence of the aortic tissue. Reduction of nitrite to NO is most probably dependent on the soluble guanylyl-cyclase enzyme, since NO release is inhibited by ODQ. (C) 2011 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Aim: To investigate the mechanism through which the extracellular alkalinization promotes relaxation in rat thoracic aorta. Methods: The relaxation response to NaOH-induced extracellular alkalinization (7.4-8.5) was measured in aortic rings pre-contracted with phenylephrine (Phe, 10(-6) M). The vascular reactivity experiments were performed in endothelium-intact and -denuded rings, in the presence or and absence of indomethacin (10(-5) M), NG-nitro-L-arginine methyl ester (L-NAME, 10(-4) M), N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide/HCl (W-7, 10(-7) M), 2,5-dimethylbenzimidazole (DMB, 2 x 10(-5) M) and methyl-B-cyclodextrin (10(-2) M). In addition, the effects of NaOH-induced extracellular alkalinization (pH 8.0 and 8.5) on the intracellular nitric oxide (NO) concentration was evaluated in isolated endothelial cells loaded with diaminofluorescein-FM diacetate (DAF-FM DA, 5 mu M), in the presence and absence of DMB (2 x 10(-5) M). Results: The extracellular alkalinization failed to induce any change in vascular tone in aortic rings pre-contracted with KCl. In rings pre-contracted with Phe, the extracellular alkalinization caused relaxation in the endothelium-intact rings only, and this relaxation was maintained after cyclooxygenase inhibition; completely abolished by the inhibition of nitric oxide synthase (NOS), Ca(2+)/calmodulin and Na(+)/Ca(2+). exchanger (NCX), and partially blunted by the caveolae disassembly. Conclusions: These results suggest that, in rat thoracic aorta, that extracellular alkalinization with NaOH activates the NCX reverse mode of endothelial cells in rat thoracic aorta, thereby the intracellular Ca(2+) concentration and activating the Ca(2+)/calmodulin-dependent NOS. In turn, NO is released promoting relaxation. (C) 2010 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A new nitrosyl ruthenium complex [Ru(NH center dot NHq)(terpy)NO](3+) nitric oxide donor was recently developed and due to its excellent vasodilator activity, it has been considered as a potential drug candidate. Drug metabolism is one of the main parameters that should be evaluated in the early drug development, so the biotransformation of this complex by rat hepatic microsomes was investigated. In order to perform the biotransformation study, a simple, sensitive and selective HPLC method was developed and carefully validated. The parameters evaluated in the validation procedure were: linearity, recovery, precision, accuracy, selectivity and stability. Except for the stability study, all the parameters evaluated presented values below the recommended by FDA guidelines. The stability study showed a time-dependent degradation profile. After method validation, the biotransformation study was accomplished and the kinetic parameters were determined. The biotransformation study obeyed the Michaelis-Menten kinetics. The V(max) and K(m) were, respectively, 0.1625 +/- 0.010 mu mol/mg protein/min and 79.97 +/- 11.52 mu M. These results indicate that the nitrosyl complex is metabolized by CYP450. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have described a new compound (trans-[RuCl([15]ane N(4))NO](2+)), which in vitro releases NO by the action of a reducing agent such as catecholamines. We investigated the effect of this NO donor in lowering the mean arterial pressure (MAP) in severe and moderate renal hypertensive 2K-1C rats. MAP was measured before and after intravenous in bolus injection of the compound in conscious 2K-1C and normotensive (2K) rats. In the hypertensive rats (basal 196.70 +/- 8.70 mmHg, n=5), the MAP was reduced in -34.25 +/- 13.50 mmHg(P < 0.05) 6 h after administration of 10 mmol/L/Kg of the compound in bolus. In normotensive rats the compound had no effect. We have also studied the effect of the injection of 0.1 mmol/L/Kg in normotensive (basal 118.20 +/- 11.25 mmHg, n = 4), moderate (basal 160.90 +/- 2.30 mmHg, n = 6), and severe hypertensive rats (basal 202.46 +/- 16.74 mmHg, n = 6). The compound at the dose of 0.1 mmol/L/Kg did not have effect (P> 0.05) on MAP of normotensive and moderate hypertensive rats. However, in the severe hypertensive rats (basal 202.46 +/- 16.70 mmHg, n = 6) there was a significant reduction on the MAP of -28.64 +/- 12.45 mmHg. The NO donor reduced the MAP of all hypertensive rats in the dose of 10 mmol/L/Kg and in the severe hypertensive rats at the dose of 0.1 mmol/L/Kg. The compound was not cytotoxic to the rat aortic vascular smooth muscle cells in the concentration of 0.1 mmol/LKg that produced the maximum relaxation. (C) 2008 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Nitric oxide (NO) in NTS plays an important role in regulating autonomic function to the cardiovascular system. Using the fluorescent dye DAF-2 DA, we evaluated the NO concentration in NTS. Brainstem slices of rats were loaded with DAF-2 DA, washed, fixed in paraformaldehyde and examined under fluorescent light. In different experimental groups, NTS slices were pre-incubated with 1 mM L-NAME (a non-selective NOS inhibitor), 1 MM D-NAME (an inactive enantiomere of L-NAME), 1 mM kynurenic acid (a nonselective ionotropic receptors antagonist) or 20 mu M bicuculline (a selective GABA(A) receptors antagonist) before and during DAF-2 DA loading. Images were acquired using a confocal microscope and the intensity of fluorescence was quantified in three antero-posterior NTS regions. In addition, slices previously loaded with DAF-2 DA were incubated with NeuN or GFAP antibody. A semi-quantitative analysis of the fluorescence intensity showed that the basal NO concentration was similar in all antero-posterior aspects of the NTS (rostral intermediate, 15.5 +/- 0.8 AU: caudal intermediate, 13.2 +/- 1.4 AU; caudal commissural, 13.8 +/- 1.4 AU, n = 10). In addition, the inhibition of NOS and the antagonism of glutamatergic receptors decreased the NO fluorescence in the NTS. On the other hand, D-NAME did not affect the NO fluorescence and the antagonism of GABAA receptors increased the NO fluorescence in the NTS. It is important to note that the fluorescence for NO was detected mainly in neurons. These data show that the fluorescence observed after NTS loading with DAF-2 DA is a result of NO present in the NTS and support the concept that NTS neurons have basal NO production which is modulated by L-glutamate and GABA. (C) 2009 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The oxidation of critical cysteines/related thiols of adenine nucleotide translocase (ANT) is believed to be an important event of the Ca(2+)-induced mitochondrial permeability transition (MPT), a process mediated by a cyclosporine A/ADP-sensitive permeability transition pores (PTP) opening. We addressed the ANT-Cys(56) relative mobility status resulting from the interaction of ANT/surrounding cardiolipins with Ca(2+) and/or ADP by means of computational chemistry analysis (Molecular Interaction Fields and Molecular Dynamics studies), supported by classic mitochondrial swelling assays. The following events were predicted: (i) Ca(2+) interacts preferentially with the ANT surrounding cardiolipins bound to the H4 helix of translocase, (ii) weakens the cardiolipins/ANT interactions and (iii) destabilizes the initial ANT-Cys(56) residue increasing its relative mobility. The binding of ADP that stabilizes the conformation ""m"" of ANT and/or cardiolipin, respectively to H5 and H4 helices, could stabilize their contacts with the short helix h56 that includes Cys(56), accounting for reducing its relative mobility. The results suggest that Ca(2+) binding to adenine nucleotide translocase (ANT)-surrounding cardiolipins in c-state of the translocase enhances (ANT)-Cys(56) relative mobility and that this may constitute a potential critical step of Ca(2+)-induced PTP opening. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The ruthenium nitrosyl complex trans-[Ru(NO)(NH(3))(4)(py)](PF(6))(3) (pyNO), a nitric oxide (NO) donor, was studied in regard to the release of NO and its impact both on isolated mitochondria and HepG2 cells. In isolated mitochondria, NO release from pyNO was concomitant with NAD(P)H oxidation and, in the 25-100 mu M range, it resulted in dissipation of mitochondrial membrane potential, inhibition of state 3 respiration, ATP depletion and reactive oxygen species (ROS) generation. In the presence of Ca(2+), mitochondrial permeability transition (MPT), an unspecific membrane permeabilization involved in cell necrosis and some types of apoptosis, was elicited. As demonstrated by externalization of phosphatidylserine and activation of caspase-9 and caspase-3, pyNO (50-100 mu M) induced HepG2 cell death, mainly by apoptosis. The combined action of the NO itself, the peroxynitrite yielded by NO in the presence of reactive oxygen species (ROS) and the oxidative stress generated by the NAD(P)H oxidation is proposed to be involved in cell death by pyNO, both via respiratory chain inhibition and ROS levels increase, or even via MPT, if Ca(2+) is present. (c) 2008 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The present article describes an L-amino acid oxidase from Bothrops atrox snake venom as with antiprotozoal activities in Trypanosoma cruzi and in different species of Leishmania (Leishmania braziliensis, Leishmania donovani and Leishmania major). Leishmanicidal effects were inhibited by catalase, suggesting that they are mediated by H(2)O(2) production. Leishmania spp. cause a spectrum of diseases, ranging from self-healing ulcers to disseminated and often fatal infections, depending on the species involved and the host`s immune response. BatroxLAAO also displays bactericidal activity against both Gram-positive and Gram-negative bacteria. The apoptosis induced by BatroxLAAO on HL-60 cell lines and PBMC cells was determined by morphological cell evaluation using a mix of fluorescent dyes. As revealed by flow cytometry analysis, suppression of cell proliferation with BatroxLAAO was accompanied by the significant accumulation of cells in the G0/G1 phase boundary in HL-60 cells. BatroxLAAO at 25 mu g/mL and 50 mu g/mL blocked G0-G1 transition, resulting in G0/G1 phase cell cycle arrest, thereby delaying the progression of cells through S and G2/M phase in HL-60 cells. This was shown by an accentuated decrease in the proportion of cells in S phase, and the almost absence of G2/M phase cell population. BatroxLAAO is an interesting enzyme that provides a better understanding of the ophidian envenomation mechanism, and has biotechnological potential as a model for therapeutic agents. (C) 2011 Elsevier Masson SAS. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have previously detected two related murine nuclear proteins, p160 and p67, that can bind to the leucine zipper motif within the negative regulatory domain of the Myb transcription factor. We now describe the molecular cloning of cDNA corresponding to murine p160. The P160 gene is located on mouse chromosome 11, and related sequences are found on chromosomes 1 and 12. The predicted p160 protein is novel, and in agreement with previous studies, we find that the corresponding 4.5-kb mRNA is ubiquitously expressed. We showed that p67 is an N-terminal fragment of p160 which is generated by proteolytic cleavage in certain cell types. The protein encoded by the cloned p160 cDNA and an engineered protein (p67*) comprising the amino-terminal region of p160 exhibit binding specificities for the Myb and Jun leucine zipper regions identical to those of endogenous p160 and p67, respectively. This implies that the Myb-binding site of p160 lies within the N-terminal 580 residues and that the Jun-binding site is C-terminal to this position. Moreover, we show that p67* but not p160 can inhibit transactivation by Myb. Unexpectedly, immunofluorescence studies show that p160 is localized predominantly in the nucleolus. The implications of these results for possible functions of p160 are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

alpha(5)beta(1) integrin from both wild-type CHO cells (CHO-K1) and deficient in proteoglycan biosynthesis (CHO-745) is post-translationally modified by glycosaminoglycan chains. We demonstrated this using [(35)S]sulfate metabolic labeling of the cells, enzymatic degradation, immunoprecipitation reaction with monoclonal antibody, fluorescence microscopy, and flow cytometry. The alpha(5)beta(1) integrin heterodimer is a hybrid proteoglycan containing both chondroitin and heparan sulfate chains. Xyloside inhibition of sulfate incorporation into alpha(5)beta(1) integrin also supports that integrin is a proteoglycan. Also. cells grown with xyloside adhered on fibronectin with no alteration in alpha(5)beta(1) integrin expression. However, haptotactic motility on fibronectin declined in cells grown with xyloside or chlorate as compared with controls. Thus, alpha(5)beta(1) integrin is a proteoglycan and the glycosaminoglycan chains of the integrin influence cell motility on fibronectin. Similar glycosylation of alpha(5)beta(1) integrin was observed in other normal and malignant cells, suggesting that this modification is conserved and important in the function of this integrin. Therefore, these glycosaminoglycan chains of alpha(5)beta(1) integrin are involved in cellular migration on fibronectin.