Environmental control on the occurrence of high-coercivity magnetic minerals and formation of iron sulfides in a 640 ka sediment sequence from Lake Ohrid (Balkans)

The bulk magnetic mineral record from Lake Ohrid, spanning the past 637 kyr, reflects large-scale shifts in hydrological conditions, and, superimposed, a strong signal of environmental conditions on glacial–interglacial and millennial timescales. A shift in the formation of early diagenetic ferrimagnetic iron sulfides to siderites is observed around 320 ka. This change is probably associated with variable availability of sulfide in the pore water. We propose that sulfate concentrations were significantly higher before  ∼  320 ka, due to either a higher sulfate flux or lower dilution of lake sulfate due to a smaller water volume. Diagenetic iron minerals appear more abundant during glacials, which are generally characterized by higher Fe / Ca ratios in the sediments. While in the lower part of the core the ferrimagnetic sulfide signal overprints the primary detrital magnetic signal, the upper part of the core is dominated by variable proportions of high- to low-coercivity iron oxides. Glacial sediments are characterized by high concentration of high-coercivity magnetic minerals (hematite, goethite), which relate to enhanced erosion of soils that had formed during preceding interglacials. Superimposed on the glacial–interglacial behavior are millennial-scale oscillations in the magnetic mineral composition that parallel variations in summer insolation. Like the processes on glacial–interglacial timescales, low summer insolation and a retreat in vegetation resulted in enhanced erosion of soil material. Our study highlights that rock-magnetic studies, in concert with geochemical and sedimentological investigations, provide a multi-level contribution to environmental reconstructions, since the magnetic properties can mirror both environmental conditions on land and intra-lake processes.

Deletion of exon 8 from the EXT1 gene causes multiple osteochondromas (MO) in a family with three affected members.

Multiple osteochondromas (also called hereditary multiple exostoses) is an autosomal dominant disorder characterized by multiple cartilaginous tumors, which are caused by mutations in the genes for exostosin-1 (EXT1) and exostosin-2 (EXT2). The goal of this study was to elucidate the genetic alterations in a family with three affected members. Isolation of RNA from the patients' blood followed by reverse transcription and PCR amplification of selected fragments showed that the three patients lack a specific region of 90 bp from their EXT1 mRNA. This region corresponds to the sequence of exon 8 from the EXT1 gene. No splice site mutation was found around exon 8. However, long-range PCR amplification of the region from intron 7 to intron 8 indicated that the three patients contain a deletion of 4318 bp, which includes exon 8 and part of the flanking introns. There is evidence that the deletion was caused by non-homologous end joining because the breakpoints are not located within a repetitive element, but contain multiple copies of the deletion hotspot sequence TGRRKM. Exon 8 encodes part of the active site of the EXT1 enzyme, including the DXD signature of all UDP-sugar glycosyltransferases. It is conceivable that the mutant protein exerts a dominant negative effect on the activity of the EXT glycosyltransferase since it might interact with normal copies of the enzyme to form an inactive hetero-oligomeric complex. We suggest that sequencing of RNA might be superior to exome sequencing to detect short deletions of a single exon.

An Intergenic Regulatory Region Mediates Drosophila Myc -Induced Apoptosis and Blocks Tissue Hyperplasia

Induction of cell-autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However, the detailed mechanism mediating this process remains enigmatic. In this study, we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (irradiation-responsive enhancer region). The IRER mediates the expression of surrounding proapoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In a previous work, we showed that the IRER also mediates P53-dependent induction of proapoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53- and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress.

Positional candidate cloning of the RP10 form of retinitis pigmentosa

Retinitis pigmentosa (RP) is a genetically heterogeneous group of retinal degenerations that affects over one million people worldwide. To date, 11 autosomal dominant, 13 autosomal recessive, and 5 X-linked forms of retinitis pigmentosa have been identified through linkage analysis, but the disease-causing genes and mutations have been found for only half of these loci. My research uses a positional candidate cloning approach to identify the gene and mutations responsible for one type of autosomal dominant retinitis pigmentosa, RP10. The premise is that identifying the genes and mutations responsible for disease will provide insight into disease mechanisms and provide treatment options. Previous research mapped the RP10 locus to a 5cM region on chromosome 7q31 between markers D7S686 and D7S530. Linkage and fine-point haplotype analysis was used to reduce and refine the RP10 disease interval to a 4cM region located between D7S2471 and a new marker located 45,000bp telomeric of D7S461. In order to identify genes located in the RP10 interval, an extensive EST map was created of this region. Five EST clusters from this map were analyzed to determine if mutations in these genes cause the RP10 form of retinitis pigmentosa. The genomic structure of a known metabotrophic glutamate receptor, GRMS8, was determined first. DNA sequencing of GRM8 in RP10 family members did not identify any disease-causing mutations. Four other EST clusters (A170, A173, A189, and A258) were characterized and determined to be part of the same gene, UBNL1 (ubinuclein-like 1). The full-length mRNA sequence and genomic structure of UBNL1 was determined and then screened in patients. No disease-causing mutations were identified in any of the RP10 family members tested. Recent data made available with the release of the public and Celera genome assemblies indicates that UBNL1 is outside of the RP10 disease region. Despite this complication, characterization of UBNL1 is still important in the understanding of normal visual processes and it is possible that mutations in UBNL1 could cause other forms of retinopathy. The EST map and list of RP10 candidates will continue to aid others in the search for the RP10 gene and mutations. ^

An extracytoplasmic function sigma factor operon regulates Myxococcus xanthus developmental gene expression

Myxococcus xanthus is a Gram-negative soil bacterium that undergoes multicellular development when high-density cells are starved on a solid surface. Expression of the 4445 gene, predicted to encode a periplasmic protein, commences 1.5 h after the initiation of development and requires starvation and high density conditions. Addition of crude or boiled supernatant from starving high-density cells restored 4445 expression to starving low-density cells. Addition of L-threonine or L-isoleucine to starving low-density cells also restored 4445 expression, indicating that the high-density signaling activity present in the supernatant might be composed of extracellular amino acids or small peptides. To investigate the circuitry integrating these starvation and high-density signals, the cis- and trans-acting elements controlling 4445 expression were identified. The 4445 transcription start site was determined by primer extension analysis to be 58 by upstream of the predicted translation start site. The promoter region contained a consensus sequence characteristic of e&barbelow;xtrac&barbelow;ytoplasmic f&barbelow;unction (ECF) sigma factor-dependent promoters, suggesting that 4445 expression might be regulated by an ECF sigma factor-dependent pathway, which are known to respond to envelope stresses. The small size of the minimum regulatory region, identified by 5′-end deletion analysis as being only 66 by upstream of the transcription start site, suggests that RNA polymerase could be the sole direct regulator of 4445 expression. To identify trans-acting negative regulators of 4445 expression, a strain containing a 4445-lacZ was mutagenized using the Himar1-tet transposon. The four transposon insertions characterized mapped to an operon encoding a putative ECF sigma factor, ecfA; an anti-sigma factor, reaA; and a negative regulator, reaB. The reaA and the reaB mutants expressed 4445 during growth and development at levels almost 100-fold higher than wild type, indicating that these genes encode negative regulators. The ecfA mutant expressed 4445-lacZ at basal levels, indicating that ecfA is a positive regulator. High Mg2+ concentrations over-stimulated this ecfA pathway possibly due to the depletion of exopolysaccharides and assembled type IV pili. These data indicate that the ecfA operon encodes a new regulatory stress pathway that integrates and transduces starvation and cell density cues during early development and is also responsive to cell-surface alterations.^

Non B-DNA structures and genomic instability associated with myotonic dystrophy type 2 (CCTG).(CAGG) repeats

There are many diseases associated with the expansion of DNA repeats in humans. Myotonic dystrophy type 2 is one of such diseases, characterized by expansions of a (CCTG)•(CAGG) repeat tract in intron 1 of zinc finger protein 9 (ZNF9) in chromosome 3q21.3. The DM2 repeat tract contains a flanking region 5' to the tract that consists of a polymorphic repetitive sequence (TG)14-25(TCTG)4-11(CCTG) n. The (CCTG)•(CAGG) repeat is typically 11-26 repeats in persons without the disease, but can expand up to 11,000 repeats in affected individuals, which is the largest expansion seen in DNA repeat diseases to date. This DNA tract remains one of the least characterized disease-associated DNA repeats, and mechanisms causing the repeat expansion in humans have yet to be elucidated. Alternative, non B-DNA structures formed by the expanded repeats are typical in DNA repeat expansion diseases. These sequences may promote instability of the repeat tracts. I determined that slipped strand structure formation occurs for (CCTG)•(CAGG) repeats at a length of 42 or more. In addition, Z-DNA structure forms in the flanking human sequence adjacent to the (CCTG)•(CAGG) repeat tract. I have also performed genetic assays in E. coli cells and results indicate that the (CCTG)•(CAGG) repeats are more similar to the highly unstable (CTG)•(CAG) repeat tracts seen in Huntington's disease and myotonic dystrophy type 1, than to those of the more stable (ATTCT)•(AGAAT) repeat tracts of spinocerebellar ataxia type 10. This instability, however, is RecA-independent in the (CCTG)•(CAGG) and (ATTCT)•(AGAAT) repeats, whereas the instability is RecA-dependent in the (CTG)•(CAG) repeats. Structural studies of the (CCTG)•(CAGG) repeat tract and the flanking sequence, as well as genetic selection assays may reveal the mechanisms responsible for the repeat instability in E. coli, and this may lead to a better understanding of the mechanisms contributing to the human disease state. ^

The transcriptional regulation of the {\it neu\/} gene: Examples of activation, repression, and cell-specific expression

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Specificity of somatostatin receptor and G -protein interactions as characterized by somatostatin receptor subtype specific antibodies

The neuropeptide somatostatin is a widely distributed general inhibitor of endocrine, exocrine, gastrointestinal and neural functions. The biological actions of somatostatin are initiated by interaction with high affinity, plasma membrane somatostatin receptors (sst receptors). Five sst receptor subtypes have been cloned and sequence analysis shows they are all members of the G protein coupled receptor superfamily. The G proteins play a pivotal role in sst receptor signal transduction and the specificity of somatostatin receptor-G protein coupling defines the possible range of cellular responses. However, the data for endogenous sst receptor and G protein coupling is very limited, and even when it is available, the sst receptor subtypes involved in G protein coupling and signal transduction are unknown due to the expression of multiple sst receptor subtypes in target cell lines or tissues of somatostatin.^ In an effort to characterize each individual sst receptor subtypes, antisera against unique C-terminal regions of different sst receptor subtypes have been developed in our lab. In this report, antisera made against the sst1, sst2A and sst4 receptors are characterized. They are highly specific to their corresponding receptors and efficiently immunoprecipitate the sst receptors. Using these antibodies, the cell lines expressing these sst receptor subtypes were identified with both immunoprecipitation and Western blot methods. The development of sst receptor subtype specific antibodies make it possible to determine the specificity of the sst receptor subtype and G protein coupling in target cells or tissues expressing multiple sst receptors, two questions were addressed by this thesis: (1) whether different cellular environments affect receptor subtype and G protein coupling; (2) whether different sst receptors couple to different G proteins in similar cellular environments.^ Taken together our findings, both sst1 and sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells, G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in GH$\sb4$C$\sb1$ cells. Further, sst2A receptors couple with G$\alpha\sb{\rm i1},$ G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in AR4-2J cells while sst4 receptors couple with G$\alpha\sb{\rm i2}$ and G$\alpha\sb{\rm i3}$ in CHO cells. Therefore, the G protein coupling of the same sst receptors in different cell lines is basically similar in that they all couple with multiple $\alpha$-subunits of the G$\rm \sb{i}$ proteins, suggesting cellular environment has little effect on receptor and G protein coupling. Moreover, different sst receptors have similar G protein coupling specificities in the same cell line, suggesting components other than receptor and G$\alpha$ subunits in the signal transduction pathways may contribute to specific functions of each sst receptor subtype. This series of experiments represent a novel approach in dissecting signal transduction pathways and may have general application in the field. Furthermore, this is the first systematic study of sst receptor subtype and G protein $\alpha$-subunit interaction in both transfected cells and in normal cell lines. The information generated will be very useful in our understanding of sst receptor signal transduction pathways and in directing future sst receptor research. ^

Mechanisms of adenovirus 5 E1A -mediated tumor suppression and E1A-mediated apoptosis

The adenovirus type 5 E1A gene products have numerous functions in cells, which serve as useful tools in studying the mechanisms of either oncogenesis or tumor suppression. To understand the mechanisms of E1A-mediated tumor suppression, we introduced an Ad5 E1A gene into murine melanoma cells, and characterized E1A-mediated biological functions both in vitro and in vivo. The results of the study indicated that: (i) Ad5 E1A mediated tumor suppression in rodent tumor cells; (ii) E1A-mediated tumor suppression is associated with E1A-mediated apoptosis in vivo.^ To determine which functional region(s) of E1A is(are) required for E1A-mediated apoptosis and whether E1A-mediated apoptosis is required for E1A-mediated tumor suppression, we established stable transfectants of E1A mutants, which have deletion mutation at either the N-terminal (p300-binding) or the CR2 (pRb-binding) domain or both, and then characterized biological functions both in vitro and in vivo. The results of the study indicate that the CR2 domain of E1A is required for E1A-mediated apoptosis, while the N-terminal domain of E1A is dispensable. Interestingly, either of the two domains is able to mediate tumor suppression, since mutant E1A with a single deletion at either domain still suppressed tumor growth. Importantly, deletion mutations at both the N-terminal and the CR2 domains of E1A abrogated E1A-mediated tumor suppression, suggesting both regions are required for E1A-mediated tumor suppression. The results demonstrate that E1A-mediated apoptosis is not the only mechanism for E1A-mediated tumor suppression. Thus, the N-terminal and CR2 domains of E1A mediated two independent mechanisms of tumor suppression.^ To understand the mechanism of E1A-mediated apoptosis, we examined the temporal relationship of molecular events during the apoptotic cascades after UV radiation and serum depletion in both the E1A-expressing cells and parental cells. Kinetic analysis of JNK activity indicates that the JNK pathway is greatly increased in response to UV light in E1A transfectants, suggesting that extracellular stress stimuli have been converted into intracellular stress signals with greater magnitude in E1A transfectants than those in parental cells. Thus, E1A-mediated sensitization precedes these events. As ceramide has been proposed as second messenger and upstream activator of JNK pathway for stress-induced apoptosis, we also examined the roles of ceramide in apoptosis and the relationship with JNK pathway. The results indicate that E1A transfectants do not have increased sensitivity to ceramide. Therefore, E1A-mediated sensitization to UV radiation cannot be attributed to an increased sensitivity to ceramide. Furthermore, UV-induced JNK activation correlates with UV-induced apoptosis, while lethal dose of ceramide does not activate JNK. Thus, activation of JNK pathway is independent of the ceramide pathway. In addition, E1A transfectants also have increased activation of NF-kB in response to UV. These results suggest that E1A-mediated sensitization is an early event which associates with conversion of extracellular stress stimuli into amplified intracellular signals. The mechanism of E1A-mediated sensitization and its relationship with other pathways are discussed. ^

Identification and evaluation of candidate genes for inherited retinal -degenerative diseases

Although more than 100 genes associated with inherited retinal disease have been mapped to chromosomal locations, less than half of these genes have been cloned. This text includes identification and evaluation of candidate genes for three autosomal dominant forms of inherited retinal degeneration: atypical vitelliform macular dystrophy (VMD1), cone-rod dystrophy (CORD), and retinitis pigmentosa (RP). ^ VMD1 is a disorder characterized by complete penetrance but extremely variable expressivity, and includes macular or peripheral retinal lesions and peripappilary abnormalitites. In 1984, linkage was reported between VMD1 and soluble glutamate-pyruvate transaminase GPT); however, placement of GPT to 8q24 on linkage maps had been debated, and VMD1 did not show linkage to microsatellite markers in that region. This study excluded linkage between the loci by cloning GPT, identifying the nucleotide substitution associated with the GPT sozymes, and by assaying VMD1 family samples with an RFLP designed to detect the substitution. In addition, linkage of VMD1 to the known dominant macular degeneration loci was excluded. ^ CORD is characterized by early onset of color-vision deficiency, and decreased visual acuity, However, this retinal degeneration progresses to no light perception, severe macular lesion, and “bone-spicule” accumulations in the peripheral retina. In this study, the disorder in a large Texan family was mapped to the CORD2 locus of 19q13, and a mutation in the retina/pineal-specific cone-rod homeobox gene (CRX) was identified as the disease cause. In addition, mutations in CRX were associated with significantly different retinal disease phenotypes, including retinitis pigmentosa and Leber congenital amaurosis. ^ Many of the mutations leading to inherited retinal disorders have been identified in genes like CRX, which are expressed predominantly in the retina and pineal gland. Therefore, a combination of database analysis and laboratory investigation was used to identify 26 novel retina/pineal-specific expressed sequence tag (EST) clusters as candidate genes for inherited retinal disorders. Eight of these genes were mapped into the candidate regions of inherited retinal degeneration loci. ^ Two of the eight clusters mapped into the retinitis pigmentosa RP13 candidate region of 17p13, and were both determined to represent a single gene that is highly expressed in photoreceptors. This gene, the Ah receptor-interacting like protein-1 (AIPL1), was cloned, characterized, and screened for mutations in RP13 patient DNA samples. ^

Interactions and structural analysis of the zinc -binding motif in decorin, a small leucine rich proteoglycan in extracellular matrix

Decorin, a dermatan/chondroitin sulfate proteoglycan, is ubiquitously distributed in the extracellular matrix (ECM) of mammals. Decorin belongs to the small leucine rich proteoglycan (SLRP) family, a proteoglycan family characterized by a core protein dominated by Leucine Rich Repeat motifs. The decorin core protein appears to mediate the binding of decorin to ECM molecules, such as collagens and fibronectin. It is believed that the interactions of decorin with these ECM molecules contribute to the regulation of ECM assembly, cell adhesions, and cell proliferation. These basic biological processes play critical roles during embryonic development and wound healing and are altered in pathological conditions such as fibrosis and tumorgenesis. ^ In this dissertation, we discover that decorin core protein can bind to Zn2+ ions with high affinity. Zinc is an essential trace element in mammals. Zn2+ ions play a catalytic role in the activation of many enzymes and a structural role in the stabilization of protein conformation. By examining purified recombinant decorin and its core protein fragments for Zn2+ binding activity using Zn2+-chelating column chromatography and Zn2+-equilibrium dialysis approaches, we have located the Zn2+ binding domain to the N-terminal sequence of the decorin core protein. The decorin N-terminal domain appears to contain two Zn2+ binding sites with similar high binding affinity. The sequence of the decorin N-terminal domain does not resemble any other reported zinc-binding motifs and, therefore, represents a novel Zn 2+ binding motif. By investigating the influence of Zn2+ ions on decorin binding interactions, we found a novel Zn2+ dependent interaction with fibrinogen, the major plasma protein in blood clots. Furthermore, a recombinant peptide (MD4) consisting of a 41 amino acid sequence of mouse decorin N-terminal domain can prolong thrombin induced fibrinogen/fibrin clot formation. This suggests that in the presence of Zn2+ the decorin N-terminal domain has an anticoagulation activity. The changed Zn2+-binding activities of the truncated MD4 peptides and site-directed mutagenesis generated mutant peptides revealed that the functional MD4 peptide might contain both a structural zinc-binding site in the cysteine cluster region and a catalytic zinc site that could be created by the flanking sequences of the cysteine cluster region. A model of a loop-like structure for MD4 peptide is proposed. ^

Mechanism of translationally coupled mRNA turnover mediated by c-fos protein-coding-region determinant

Proto-oncogene c-fos is a member of the class of early-response genes whose transient expression plays a crucial role in cell proliferation, differentiation, and apoptosis. Degradation of c- fos mRNA is an important mechanism for controlling c-fos expression. Rapid mRNA turnover mediated by the protein-coding-region determinant (mCRD) of the c-fos transcript illustrates a functional interplay between mRNA turnover and translation that coordinately influences the fate of cytoplasmic mRNA. It is suggested that mCRD communicates with the 3′ poly(A) tail via an mRNP complex comprising mCRD-associated proteins, which prevents deadenylation in the absence of translation. Ribosome transit as a result of translation is required to alter the conformation of the mRNP complex, thereby eliciting accelerated deadenylation and mRNA decay. To gain further insight into the mechanism of mCRD-mediated mRNA turnover, Unr was identified as an mCRD-binding protein, and its binding site within mCRD was characterized. Moreover, the functional role for Unr in mRNA decay was demonstrated. The result showed that elevation of Unr protein level in the cytoplasm led to inhibition of mRNA destabilization by mCRD. In addition, GST pull-down assay and immuno-precipitation analysis revealed that Unr interacted with PABP in an RNA-independent manner, which identified Unr as a novel PABP-interacting protein. Furthermore, the Unr interacting domain in PABP was characterized. In vivo mRNA decay experiments demonstrated a role for Unr-PABP interaction in mCRD-mediated mRNA decay. In conclusion, the findings of this study provide the first evidence that Unr plays a key role in mCRD-mediated mRNA decay. It is proposed that Unr is recruited by mCRD to initiate the formation of a dynamic mRNP complex for communicating with poly(A) tail through PABP. This unique mRNP complex may couple translation to mRNA decay, and perhaps to recruit the responsible nuclease for deadenylation. ^

Expression regulation of AP -2 gamma gene

AP-2γ is a member of the AP-2 transcription factor family, is highly enriched in the trophoblast cell lineage, and is essential for placenta development. In an effort to identify factors regulating AP-2γ gene expression we isolated and characterized the promoter and 5′ flanking region of the mouse and human AP-2γ genes. The transcription start site of the mouse AP-2γ gene was mapped by primer extension and 5′ RACE. Transient gene transfer studies showed that basal promoter activity resides within a highly conserved ∼200 by DNA sequence located immediately upstream of the transcription start site. The conserved region is highly GC-rich and lacks typical TATA or CCAAT boxes. Multiple potential Sp and AP-2 binding sites are clustered within this region. Electrophoretic mobility shift assays demonstrated that Sp1 and Sp3 bind to three sites in the promoter region of the mouse AP-2γ gene. Combined mutation of the three putative Sp sites reduced promoter activity by 80% in trophoblast and non-trophoblast cells, demonstrating the functional importance of these sites in AP-2γ gene expression. ^ Mutational analysis of the 5′-flanking region revealed a 117-bp positive regulatory region of the mouse AP-2γ gene located between −5700 and −5583 upstream of the transcription start site. This 117-bp positive regulatory element provided approximately 7-fold enhancement of reporter gene expression in cultured trophoblast cells. A C/EBP-Sp1 transcription factor-binding module is located in this DNA sequence. Electrophoretic mobility shift assays demonstrated that transcription factors Sp1, Sp3 and C/EBP bind to the enhancer element. Mutation of each protein-binding site reduced the enhanced expression significantly. Mutagenesis assays showed that two other protein-binding sites also contribute to the enhancer activity. In summary, we have shown that Sp1 and Sp3 bind to cis-regulatory elements located in the promoter region and contribute to basal promoter activity. We have identified a 117-bp positive regulatory element of AP-2γ gene, and we have shown that Sp and C/EBP proteins bind to the cis -regulatory elements and contribute to the enhanced gene expression. ^

Cenozoic planktonic foraminifera in the Goban Spur Region

Cenozoic planktonic foraminiferal biostratigraphy at DSDP-IPOD Leg 80 sites documents the existence of regionwide stratigraphic gaps in the Paleocene and middle Miocene. Episodes of carbonate dissolution also occurred during the Paleocene at several sites, particularly at Site 549, where destruction of foraminiferal tests may obscure evidence of an unconformity. The middle Miocene hiatus is apparent at each site where Neogene sediments were continuously cored. Upper Miocene sediments at Site 550 (the only abyssal site) are characterized by moderate to extensive dissolution of planktonic foraminifers, but they contain abundant specimens of Bolboforma that mark this stratigraphic interval (von Daniels and Spiegler, 1974, doi:10.1007/BF02986990; Roegl, 1976, doi:10.2973/dsdp.proc.35.133.1976; Murray, 1979, doi:10.2973/dsdp.proc.48.116.1979; Müller et al., 1985, doi:10.2973/dsdp.proc.80.117.1985). Although foraminiferal evidence is not conclusive, nannofossils indicate a widespread Oligocene unconformity (Müller, 1985). Several oceanographic factors, not just simple sea-level change, probably interacted to produce these regional unconformities. There are also dramatic differences in the Cenozoic sedimentary record among Leg 80 sites, indicating that each has had a distinct geologic history. The thickness of the Cenozoic section varies from 100 m at Site 551 to 471 m at Site 548. The thickness of individual chronostratigraphic units also varies, as do the number and stratigraphic position of unconformities other than those mentioned. Differences in the stratigraphic record from site to site across the continental slope result from (1) location in separate half-graben structures, (2) varying location across the developing margin, and (3) difference in position relative to the seaward edge of the enclosing half-graben. Except for turbidites, deposition at Site 550 (abyssal) was largely independent of developments on the continental slope; but it was affected by oceanographic events widespread in the North Atlantic.