862 resultados para four-circle diffraction
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.
Resumo:
The ability of four operational weather forecast models [ECMWF, Action de Recherche Petite Echelle Grande Echelle model (ARPEGE), Regional Atmospheric Climate Model (RACMO), and Met Office] to generate a cloud at the right location and time (the cloud frequency of occurrence) is assessed in the present paper using a two-year time series of observations collected by profiling ground-based active remote sensors (cloud radar and lidar) located at three different sites in western Europe (Cabauw. Netherlands; Chilbolton, United Kingdom; and Palaiseau, France). Particular attention is given to potential biases that may arise from instrumentation differences (especially sensitivity) from one site to another and intermittent sampling. In a second step the statistical properties of the cloud variables involved in most advanced cloud schemes of numerical weather forecast models (ice water content and cloud fraction) are characterized and compared with their counterparts in the models. The two years of observations are first considered as a whole in order to evaluate the accuracy of the statistical representation of the cloud variables in each model. It is shown that all models tend to produce too many high-level clouds, with too-high cloud fraction and ice water content. The midlevel and low-level cloud occurrence is also generally overestimated, with too-low cloud fraction but a correct ice water content. The dataset is then divided into seasons to evaluate the potential of the models to generate different cloud situations in response to different large-scale forcings. Strong variations in cloud occurrence are found in the observations from one season to the same season the following year as well as in the seasonal cycle. Overall, the model biases observed using the whole dataset are still found at seasonal scale, but the models generally manage to well reproduce the observed seasonal variations in cloud occurrence. Overall, models do not generate the same cloud fraction distributions and these distributions do not agree with the observations. Another general conclusion is that the use of continuous ground-based radar and lidar observations is definitely a powerful tool for evaluating model cloud schemes and for a responsive assessment of the benefit achieved by changing or tuning a model cloud
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.
Resumo:
The surface geometries of the p (root7- x root7)R19degrees-(4CO) and c(2 x 4)-(2CO) layers on Ni {111} and the clean Ni {111} surface were determined by low energy electron diffraction structure analysis. For the clean surface small but significant contractions of d(12) and d(23) (both 2.02 Angstrom) were found with respect to the bulk interlayer distance (2.03 Angstrom). In the c(2 x 4)-(2CO) structure these distances are expanded, with values of d(12) = 2.08 Angstrom and d(23) = 2.06 Angstrom and buckling of 0.08 and 0.02 Angstrom, respectively, in the first and second layer. CO resides near hcp and fcc hollow sites with relatively large lateral shifts away from the ideal positions leading to unequal C-Ni bond lengths between 1.76 and 1.99 Angstrom. For the p(root7- x root7-)R19'-(4CO) layer two best fit geometries were found, which agree in most of their atomic positions, except for one out of four CO molecules, which is either near atop or between bridge and atop. The remaining three molecules reside near hcp and fcc sites, again with large lateral deviations from their ideal positions. The average C Ni bond length for these molecules is, however, the same as for CO on hollow sites at low coverage. The average CNi bond length at hollow sites, the interlayer distances, and buckling in the first Ni layer are similar to the c(2 x 4)(2CO) geometry, only the buckling in the second layer (0.08 Angstrom) is significantly larger. Lateral and vertical shifts of the Ni atoms in the first layer lead to unsymmetric environments for the CO molecules, which can be regarded as an imprint of the chiral p(root7- x root7-)R19degrees lattice geometry onto the substrate.
Resumo:
We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.
Resumo:
We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.
Resumo:
A simple relationship is described which connects Buffon's classical needle problem with related problems involving circles, squares and rectangles.
Resumo:
Rh-I-terpyridine complexes have been unambiguously formed for the first time. The 2,21:6',2"-terpyridine (tpy), 4'-chloro-2,2':6',2"-terpyridine (4'-Cl-tpy) and 4'-(tert-butyldimethylsilyl-ortho-carboranyl)-2,2':6',2"-terpyridine (carboranyl-tpy) ligands were used for successful syntheses and characterisation of the corresponding Rh-I complexes with halide coligands, [Rh(X)(4'-Y-terpyridine)] (X = Cl, Y = H, Cl, carboranyl; X = Br, Y = H). All four neutral Rh-tpy complexes are square planar, with Rh-X bonds in the plane of the 4'-Y-terpyridine ligands. Full characterisation of these dark blue, highly air-sensitive compounds was hampered by their poor solubility in various organic solvents. This is mainly due to the formation of pi-stacked aggregates, as evidenced by the crystal structure of [Rh(Cl)(tpy)]; in addition, [Rh(Cl)(carboranyl-tpy)] merely forms discrete dimers. The (bonding) properties of the novel Rh-I-terpyridine complexes have been studied with single-crystal X-ray diffraction, (time-dependent) density functional theoretical (DFT) calculations, far-infrared spectroscopy, electronic absorption spectroscopy and cyclic voltammetry. From DFT calculations, the HOMO of the studied Rh-I-terpyridine complexes involves predominantly the metal centre, while the LUMO resides on the terpyridine ligand. Absorption bands of the studied complexes in the visible region (400-900 nm) can be assigned to MLCT and MLCT/XLCT transitions. The relatively low oxidation potentials of [Rh(X)(tpy)] (X = Cl, Br) point to a high electron density on the metal centre. This makes the Rh-I-terpyridine complexes strongly nucleophilic and (potentially) highly reactive towards various (small) substrate molecules containing carbon-halide bonds.
Resumo:
Manipulation of an object by a multi-fingered robot hand requires task planning which involves computation of joint space vectors and fingertip forces. To implement a task as fast as possible, computations have to be carried out in minimum time. The state of the art in manipulation by multi-fingered robot hand designs has shown the possible use of remotely driven finger joints. Such remotely driven hands require computation of tendon displacement for evaluating joint space vectors before signals are sent to actuators. Alternatively, a direct drive hand is a mechanical hand in which the shafts of articulated joints are directly coupled to the rotors of motors with high output torques. This article has been divided into two main sections. The first section presents a brief view of manipulation using a direct drive approach. Meanwhile, the other section presents ongoing research which is being carried out to design a four-finger articulated hand in the Department of Cybernetics at the University of Reading.
Resumo:
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Resumo:
Current forest growth models and yield tables are almost exclusively based on data from mature trees, reducing their applicability to young and developing stands. To address this gap, young European beech, sessile oak, Scots pine and Norway spruce trees approximately 0 to 10 years old were destructively sampled in a range of naturally regenerated forest stands in Central Europe. Diameter at base and height were first measured in situ for up to 175 individuals per species. Subsequently, the trees were excavated and dry biomass of foliage, branches, stems and roots was measured. Allometric relations were then used to calculate biomass allocation coefficients (BAC) and growth efficiency (GE) patterns in young trees. We found large differences in BAC and GE between broadleaves and conifers, but also between species within these categories. Both BAC and GE are strongly age-specific in young trees, their rapidly changing values reflecting different growth strategies in the earliest stages of growth. We show that linear relationships describing biomass allocation in older trees are not applicable in young trees. To accurately predict forest biomass and carbon stocks, forest growth models need to include species and age specific parameters of biomass allocation patterns.