Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

Macrophage-colony-stimulating factor regulates expression of the integrins alpha 4 beta 1 and alpha 5 beta 1 by murine bone marrow macrophages.

We observed that when monocyte/macrophage precursors derived from murine bone marrow were treated with macrophage-colony-stimulating factor (M-CSF), there was a dose-dependent increase in both the number of adherent cells and the degree to which the cells were highly spread. Attachment was supported by fibronectin, but not by vitronectin or laminin, suggesting that the integrins alpha 4 beta 1 and/or alpha 5 beta 1 might mediate this event. Binding to fibronectin was blocked partially by antibodies to either integrin, and inhibition was almost complete when the antibodies were used in combination. By a combination of surface labeling with 125I and metabolic labeling with [35S]methionine and [35S]cysteine, we demonstrated that M-CSF treatment led to increased synthesis and surface expression of the two beta 1 integrins. Since attachment to fibronectin and/or stromal cells plays an important role in the maturation of other hematopoietic lineages, we propose that the action of M-CSF in the differentiation of immature monocytes/macrophages includes stimulated expression of the integrins alpha 4 beta 1 and alpha 5 beta 1, leading to interactions with components of the marrow microenvironment necessary for cell maturation.

Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Electro-mechanical coupling in the aging heart: role of the Late Na+ current

The aging myopathy manifests itself with diastolic dysfunction and preserved ejection fraction. However, the difficulty in defining myocardial aging and the mechanisms involved complicates the recognition of the cellular processes underlying impaired diastolic relaxation. We raised the possibility that, in a mouse model of physiological aging, defects in the electromechanical properties of cardiomyocytes are important determinants of the diastolic properties of the myocardium, independently from changes in the structural composition of the muscle and collagen framework. Here we show that an increase in the late Na+ current (INaL) in aging cardiomyocytes prolongs the action potential (AP) and influences the temporal kinetics of Ca2+ cycling and cell shortening. These alterations increase force development and passive tension. Inhibition of INaL shortens the AP and corrects the dynamics of Ca2+ transient, cell contraction and relaxation. Similarly, repolarization and diastolic tension of the senescent myocardium are partly restored. INaL offers inotropic support, but negatively interferes with cellular and ventricular compliance, providing a new perspective of the biology of myocardial aging and the etiology of the defective cardiac performance in the elderly.

Mobility and Aging in Denver, Colorado: Travel Behavior, Mobility Barriers, and Perceptions of Transit

The number of seniors in the U.S. today is growing rapidly because of longer life expectancies and the aging Baby Boomer generation. This age groups' travel behavior will have substantial impacts on transportation, economics, safety, and the environment. This research used a mixed-methods approach to address issues of mobility and aging in Denver, Colorado. A quantitative approach was used to answer broad questions about travel behavior and the effects of age, gender, work status, disability, residential location and socio-economic status on mobility. Qualitative interviews with seniors in the Denver metro area were conducted to identify barriers to mobility, decision-making processes and travel decisions, and seniors' perceptions of public transit. The results of the quantitative and qualitative analyses show that residential location is an important variable for determining seniors' travel behaviors and transportation options. Perceptions of public transit were positive, but accessibility and information barriers exist that prevent older adult from using transit. The findings of this study will help to provide transportation and service recommendations to policymakers and planners in the Denver area as well as to inform studies of other North American cities with large aging populations.

Challenges and Opportunities in Managing the Aging Workforce: An Investigation of the Federal Emergency Management Agency

The aging workforce is becoming the majority of the working population in the United States. Although the literature on the aging workforce is sizable, little exists on how public agencies use the older workers. This capstone project examines the challenges and opportunities related to the employment of older workers as seen through a case study of the Federal Emergency Management Agency (FEMA). Knowledge gained from a synthesis of the literature review with survey data collected and analyzed will enable HR professionals to better understand the demographic, economic, regulatory, and intellectual influences of the aging workforce. The results from the survey of FEMA employees suggest a basis to plan and implement successful hiring and retention policies related to the aging workforce.

List of books donated by Francis Bernard, Governor of the Massachusetts Bay Colony, undated

Bracketed annotation made by John Langdon Sibley in Feb. 1842: "The books on this & the three succeeding pages, I find on examination, to have been given by Gov. Bernard." On the fourth page, presumably also in 1842, Sibley wrote: "This is a list of donations by Gov. Bernard, & not by Hollis."

Motion for change of venue in the case of the Inhabitants of Massachusetts Bay Colony v. Charles Paxton, October 1761

A motion that the case not be tried in Suffolk County, on the grounds that the judges and jurors were residents of the colony. Pratt was attorney to Paxton, an attorney and commissioner of customs, who had incurred a debt to the Colony.

An elegie on the deplored decease of that truly pious and religious matron, Mrs. Sara Leveret: relict of the late hon[or]able John Leveret, Esq., sometime governor of his then Majesty's colony of the Massethusets [sic] Bay in New England : manuscript, 1704

Autograph copy, signed.

Old Colony Railroad, Massachusetts, 1873 (Raster Image)

This layer is a georeferenced raster image of the historic paper map entitled: Old Colony Railroad and connections, [by] E.N. Winslow, del. It was published in 1873. Covers southeastern Massachusetts, from Boston to Cape Cod. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, railroads, railroad stations, drainage, town boundaries and more. Includes two illustrations. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.

Understanding Seniors' Perceptions and Stereotypes of Aging

Research suggests there is a connection between stereotypes, beliefs, and behavior in older individuals. To explore this link of stereotypes affecting beliefs and beliefs affecting behavior, we interviewed young (age 60 to 75) seniors in an effort to further examine these relationships. Semistructured qualitative interviews were conducted with 20 seniors. Questions focused on the broad themes of aging stereotypes and attitudes towards active living. Responses from the participants indicated the variety of opinions and beliefs seniors hold about the aging process. Intriguing results emerged on the topic of role models. Participants often had someone in their lives who represented what it means to age successfully. Generally, this was an individual older than themselves, active, vigorous, and illustrative of the high quality of life that is possible into a very late age. In addition, these individuals provide a direct contrast to the most negative stereotypes of aging.