928 resultados para Social identity, constituting another regulatory factor
Resumo:
In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as superoxide dismutase (SOD) and catalase. Here we describe the isolation and characterization of another gene in the yeast Saccharomyces cerevisiae that plays a critical role in detoxification of reactive oxygen species. This gene, named ATX1, was originally isolated by its ability to suppress oxygen toxicity in yeast lacking SOD. ATX1 encodes a 8.2-kDa polypeptide exhibiting significant similarity and identity to various bacterial metal transporters. Potential ATX1 homologues were also identified in multicellular eukaryotes, including the plants Arabidopsis thaliana and Oryza sativa and the nematode Caenorhabditis elegans. In yeast cells, ATX1 evidently acts in the transport and/or partitioning of copper, and this role in copper homeostasis appears to be directly relevant to the ATX1 suppression of oxygen toxicity: ATX1 was incapable of compensating for SOD when cells were depleted of exogenous copper. Strains containing a deletion in the chromosomal ATX1 locus were generated. Loss of ATX1 function rendered both mutant and wild-type SOD strains hypersensitive toward paraquat (a generator of superoxide anion) and was also associated with an increased sensitivity toward hydrogen peroxide. Hence, ATX1 protects cells against the toxicity of both superoxide anion and hydrogen peroxide.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
This conceptual study explores ethnic identity development theory in order to argue that ethnic identity development education is a means of developing broad senses of community in the African Diaspora that expand beyond a tribal, local, familial level. This study suggests that the broadening of community understanding would contribute to establishing social sustainability on regional, national and international levels within the Pan African community. Establishing such social sustainability would have direct effects on the areas of economic and environmental sustainability. One of the goals of this project is to offer suggestions for ethnically relevant education that can develop social sustainability in several places throughout the Diaspora, such as in Nigeria where ethnic conflicts are a contemporary concern.
Resumo:
All agricultural markets are subjected to institutional regulations that – in one way or another –affect the functioning of these markets, and this is no different for the agricultural land market in the EU. In this paper, we describe the existing regulations in the sales markets for agricultural land in selected EU member states and candidate countries. The analysis focuses on three types of sales market regulations and institutions: quantity regulations, price regulations and transaction costs. The differences in the regulatory framework between land acquisition and ownership by domestic and foreign investors are analysed, as well as the taxes associated with land sales and ownership, zoning regulations and market imperfections.
Resumo:
While many factors have been studied in relation to the functioning of land markets, the role of land distribution has received relatively little attention. In this paper, we ask to what extent farmers’ propensity to buy land is related to the difference between them and their neighbours in terms of land ownership. To this end, we employ the concept of relative deprivation. Drawing on micro-level data from the transition period in Poland and using both OLS and instrumental variables strategy, we find that interpersonal comparisons with others in one’s reference group may have motivated a farmer’s behaviour in the land market. In particular, the propensity to purchase land is positively associated with experiencing higher relative deprivation. In addition, this relationship waned over time in a predictable manner: late in the transition period it was weaker than at the beginning of the period.
Resumo:
This course, then, investigates the effects of integration on European citizens as well as the duality of the EU as a competitive and social model. It is sensitive to the involvement of social groups, protest, and domestic politics in the study of market integration. Some of the questions we explore are: What are the effects of regulatory policy-making on social actors, how do such actors’ strategies and behaviors change as a consequence, and how to they overcome their collective action problems? Why is it that the logic of integration has at times followed a logic of “permissive consensus” while at other times it has been described as a “constraining dissensus”? What is the importance of discourse in domestic politics in order to articulate and legitimate Europeanization? How do European identities change as a consequence of policymaking as well as of protest? To what extent do ordinary Europeans matter in terms of accepting and opposing the project of European integration, how do European citizens in core and peripheral EU states experience Europeanization, and how is their involvement in the integration project to be conceptualized?
Resumo:
Bibliography: p. 187-188.
Resumo:
Mode of access: Internet.
Resumo:
Mode of access: Internet.