Influência de fatores ambientais na incidência do vírus da infecção hipodermal e necrose hematopoiética (IHHNV) no camarão Litopenaeus vannamei cultivado em fazendas do Estado do Rio Grande do Norte (RN)

The shrimp farming industry is the most profitable area of the aquaculture at Rio Grande do Norte (RN) state, which is one of the largest producers in Brazil. However the infections that affect the shrimp cause major economic losses. The infection is a result of the interaction between the shrimp, the environment and pathogen. The change of these factors may lead to a condition of stress and susceptibility to opportunistic infections. One of these infections caused by Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) is widely distributed in several countries and affects a wide range of hosts. To optimize conditions for production of Litopenaeus vannamei shrimp, the more species cultivated in Brazil, it is necessary to understand the effects of environmental factors in the susceptibility of this species to infections. The aim of this study was to determine the IHHNV prevalence and to investigate the influence of environmental factors as salinity, temperature, stocking density, dissolved oxygen and rainfall in the IHHNV incidence in L. vannamei grown in farms, in the RN state. To determine the IHHNV prevalence were used 1089 samples of L. vannamei collected in seven farms. To perform the study about the influence of environmental factors, 525 samples of L. vannamei shrimp were collected in eight farms located in regions of low (0-1 ), medium (21-30 ) and high (38-57 ) salinity, using extensive (≤15 shrimp/m2 ), semi-intensive (18-33 shrimp/m2) or intensive (>36 shrimp/m2) stocking density systems. The IHHNV infection was determined in pleopod and hemolymph using the polymerase chain reaction (PCR). The environmental factors were recorded during the collection of animals, using a refractometer to measure the salinity and a multi-parameter meter to measure the temperature and concentration of dissolved oxygen in the water. The IHHNV prevalence in RN was 43% (468 infected shrimp out of 1089), varying on different farms. On the seven farms studied, IHHNV prevalence ranged from 18.6% to 54.8%. The infection rates in the shrimp cultured in low, medium and high salinity were respectively 43.10% (125/290), 31.2% (15/48) and 24.6% (46/187) and was significantly higher in shrimp grown in low salinity (P<0.001). The infection rates in ponds of extensive, semi-intensive and intensive systems were respectively, 28.7%, 28.28% and 47.84%, and was significantly higher in high stocking densities (P<0.001). This study indicated a high IHHNV prevalence and a significant effect of salinity and stocking density, but not of the temperature, rainfall and dissolved oxygen on the IHHNV infection rate in the L. vannamei shrimp cultured in the northeastern Brazil

Rotavírus bovino: fatores de risco, prevalência e caracterização antigênica de amostras em rebanhos leiteiros no estado de São Paulo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Sexagem de embriões bovinos fecundados in vitro pela técnica de PCR multiplex

Neste trabalho, a técnica de PCR (polymerase chain reaction) foi utilizada para a sexagem de 92 embriões bovinos fertilizados in vitro. Os embriões originaram-se de fertilização in vitro de oócitos aspirados de ovários de fêmeas bovinas, provenientes de abatedouros comerciais. Os oócitos foram maturados, fertilizados e cultivados até o estádio de blastocisto. Os embriões foram lavados em solução de PBS, transferidos para tubos de polipropileno contendo água ultrapura, e imediatamente congelados a -196ºC. Os embriões foram descongelados sobre isopor contendo gelo picado e tratados com proteinase K. Para a reação de PCR, utilizaram-se alíquotas de 34 µl de cada tudo, onde foram acrescidos dois pares de primers, seqüência BC1.2 e seqüência satélite 1.715, desoxinucleotídeos, MgCl2, tampão PCR 10X, TaqDNA polimerase e água, em um volume final de 50 µl. As amostras foram amplificadas e a eletroforese realizada em gel de poliacrilamida a 8%. Os géis foram corados com solução de brometo de etídio e analisados em transiluminador de luz ultravioleta. Um índice de 93,47% de amplificação foi atingido, com 41 embriões (47,67%) machos e 45 (52,32%) embriões fêmeas. O uso de gel de poliacrilamida a 8% foi eficaz na separação de fragmentos de DNA muito próximos.

Um sistema computacional para diagnosticar viroses de plantas usando a técnica de PCR com construção de primers espécie-específicos

It proposes a established computational solution in the development of a software to construct species-specific primers, used to improve the diagnosis of virus of plant for PCR. Primers are indispensable to PCR reaction, besides providing the specificity of the diagnosis. Primer is a synthetic, short, single stranded piece of DNA, used as a starter in PCR technique. It flanks the sequence desired to amplify. Species-specific primers indicate the well known region of beginning and ending where the polymerase enzyme is going to amplify on a certain species, i.e. it is specific for only a species. Thus, the main objective of this work is to automatize the process of choice of primers, optimizing the specificity of chosen primers by the traditional method

Sobrevivência de Xanthomonas axonopodis pv. manihotis em manipueira sob condições ambientais

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Detection of enterotoxins genes in coagulase-negative staphylococci isolated from foods

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Stem cell factor estimula células da musculatura lisa da traqueia a produzir TGF-β, FGF-2 E CCL3/MIP-1α

Pós-graduação em Ciências Fisiológicas - FOA

Papilomavírus humano e a carcinogênse de mucosa oral: avaliação imunohistoquímica das protínas p27, mdm2 E catepsina B

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Expressão da proteína S1 recombinante do vírus da bronquite infecciosa em Saccharomyces cerevisiae para aplicação no imunodiagnóstico

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Aspectos epidemiológicos da infecção por Hepatozoon spp.(Apicomplexa: hepatozoidae) em cães de áreas rurais do Estado de São Paulo, Brasil e caracterização molecular de isolados

Pós-graduação em Medicina Veterinária - FMVZ

Separação de virus de importância fitopatológica em citros: CTV e CSDaV através de citometria de fluxo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Ocorrência e transmissão transplacentária de Neospora caninum em novilhas prenhes

Pós-graduação em Medicina Veterinária - FMVZ

Surto de encefalomielite equina Leste na Ilha de Marajó, Pará

Nove casos de encefalomielite equina foram estudados na Ilha de Marajó, estado do Pará, Brasil. Os equinos apresentavam dificuldade em se manter em estação, andavam em círculo, tinham acentuada depressão, pálpebras cerradas, paralisia da língua, tremores musculares, bruxismo, anorexia e desidratação. Alguns apresentavam diminuição dos reflexos auricular, palpebral, de ameaça, diminuição do tônus da língua e taquicardia. Posição de auto-auscultação foi observada com frequência. Os animais muitas vezes eram encontrados apoiados em troncos e cercas para se manterem em estação. À necropsia verificou-se hemorragia das leptomeninges e da medula, alguns apresentaram ainda aderência das leptomeninges. À histopatologia verificou-se encefalite difusa que afetava principalmente a substância cinzenta, com meningite e coroidite. Foi observada perivasculite mononuclear. Em dois equinos identificou-se o vírus da encefalomielite equina Leste pela reação de Semi-Nested transcrição reversa de polimerase em cadeia (Semi-Nested RT-PCR).

Molecular characterization of accessions of crabgrass (Digitaria nuda) and response to ametryn

Digitaria species are sugar cane crop weeds in Brazil and are being controlled with herbicides, although there are some reports of control failure, notably to the triazine group. Molecular techniques are recommended to analyze the genetic variability in weeds. RAPD (Random Amplified Polymorphic DNA), PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism) and, in combination with sequencing, allow the localization of resistance genes, as well as possible mutations related to the onset of resistant individuals in some species. Thus, the objective of this work was to characterize ten accessions of Digitaria spp. by RAPD and PCR-RFLP markers, to sequence a conserved region of the psbA gene and evaluate the accessions response to ametryn. As showed by molecular analysis there was high genetic similarity among the accessions, all of them presented similar genetics profiles and were susceptible to ametryn.