861 resultados para Periodic solutions


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We study the numerical efficiency of solving the self-consistent field theory (SCFT) for periodic block-copolymer morphologies by combining the spectral method with Anderson mixing. Using AB diblock-copolymer melts as an example, we demonstrate that this approach can be orders of magnitude faster than competing methods, permitting precise calculations with relatively little computational cost. Moreover, our results raise significant doubts that the gyroid (G) phase extends to infinite $\chi N$. With the increased precision, we are also able to resolve subtle free-energy differences, allowing us to investigate the layer stacking in the perforated-lamellar (PL) phase and the lattice arrangement of the close-packed spherical (S$_{cp}$) phase. Furthermore, our study sheds light on the existence of the newly discovered Fddd (O$^{70}$) morphology, showing that conformational asymmetry has a significant effect on its stability.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We prove that all the eigenvalues of a certain highly non-self-adjoint Sturm–Liouville differential operator are real. The results presented are motivated by and extend those recently found by various authors (Benilov et al. (2003) [3], Davies (2007) [7] and Weir (2008) [18]) on the stability of a model describing small oscillations of a thin layer of fluid inside a rotating cylinder.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In a previous paper (J. of Differential Equations, Vol. 249 (2010), 3081-3098) we examined a family of periodic Sturm-Liouville problems with boundary and interior singularities which are highly non-self-adjoint but have only real eigenvalues. We now establish Schatten class properties of the associated resolvent operator.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Climate change is expected to produce reductions in water availability in England, potentially necessitating adaptive action by the water industry to maintain supplies. As part of Ofwat's fifth Periodic Review (PR09), water companies recently released their draft Water Resources Management Plans, setting out how each company intends to maintain the balance between the supply and demand for water over the next 25 years, following Environment Agency guidelines. This paper reviews these plans to determine company estimates of the impact of climate change on water supply relative to other resource pressures. The approaches adopted for incorporating the impact in the plans and the proposed management solutions are also identified. Climate change impacts for individual resource zones range from no reductions in deployable output to greater than 50% over the planning period. The estimated national aggregated loss of deployable output under a “core” climate scenario is ~520 Ml/d (3% of deployable output) by 2034/35, the equivalent of the supply of one entire water company (South West Water). Climate change is the largest single driver of change in water supplies over the planning period. Over half of the climate change impact is concentrated in southern England. In extreme cases, climate change uncertainty is of the same magnitude as the change under the core scenario (up to a loss of ~475 Ml/d). 44 of the 68 resource zones with available data are estimated to have a climate change impact. In 35 of these climate change has the greatest impact although in 10 zones sustainability reductions have a greater impact. Of the overall change in downward pressure on the supply-demand balance over the planning period, ~56% is accounted for by increased demand (620 Ml/d) and supply side climate change accounts for ~37% (407 Ml/d). Climate change impacts have a cumulative impact in concert with other changing supply side reducing components increasing the national pressure on the supply-demand balance. Whilst the magnitude of climate change appears to justify its explicit consideration, it is rare that adaptation options are planned solely in response to climate change but as a suite of options to provide a resilient supply to a range of pressures (including significant demand side pressures). Supply-side measures still tend to be considered by water companies to be more reliable than demand-side measures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper studies periodic traveling gravity waves at the free surface of water in a flow of constant vorticity over a flat bed. Using conformal mappings the free-boundary problem is transformed into a quasilinear pseudodifferential equation for a periodic function of one variable. The new formulation leads to a regularity result and, by use of bifurcation theory, to the existence of waves of small amplitude even in the presence of stagnation points in the flow.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In the present paper, we studied the preparation of biomimetic triblock copolymer (ABA) membranes in aqueous solution and their deposition into solid supports. The self-assembly structures of the ABA in aqueous solution was investigated by using optical microscopy, dynamic light scattering, electron microscopy (EM) and SAXS. Spherical and tubular polymersomes were found at the highest concentrations investigated. The mechanism of deposition on solid supports (mica and glass) was elucidated by using atomic force microscopy (AFM). The deposition results in the formation of a uniform defect-free membrane at suitable polymer concentrations.