882 resultados para Neutron transfer
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The first example of an intramolecular enantioselective Michael addition of nitronates onto conjugated systems utilizing a chiral phase-transfer catalyst is described. A range of five-membered gamma-nitro esters with up to three stereocentres have been prepared and the relative and absolute configurations proven by chemical and crystallographic methods. The products are rapidly obtained and are precursors to five-membered cyclic gamma-amino acids.
Resumo:
The correlated k-distribution (CKD) method is widely used in the radiative transfer schemes of atmospheric models and involves dividing the spectrum into a number of bands and then reordering the gaseous absorption coefficients within each one. The fluxes and heating rates for each band may then be computed by discretizing the reordered spectrum into of order 10 quadrature points per major gas and performing a monochromatic radiation calculation for each point. In this presentation it is shown that for clear-sky longwave calculations, sufficient accuracy for most applications can be achieved without the need for bands: reordering may be performed on the entire longwave spectrum. The resulting full-spectrum correlated k (FSCK) method requires significantly fewer monochromatic calculations than standard CKD to achieve a given accuracy. The concept is first demonstrated by comparing with line-by-line calculations for an atmosphere containing only water vapor, in which it is shown that the accuracy of heating-rate calculations improves approximately in proportion to the square of the number of quadrature points. For more than around 20 points, the root-mean-squared error flattens out at around 0.015 K/day due to the imperfect rank correlation of absorption spectra at different pressures in the profile. The spectral overlap of m different gases is treated by considering an m-dimensional hypercube where each axis corresponds to the reordered spectrum of one of the gases. This hypercube is then divided up into a number of volumes, each approximated by a single quadrature point, such that the total number of quadrature points is slightly fewer than the sum of the number that would be required to treat each of the gases separately. The gaseous absorptions for each quadrature point are optimized such that they minimize a cost function expressing the deviation of the heating rates and fluxes calculated by the FSCK method from line-by-line calculations for a number of training profiles. This approach is validated for atmospheres containing water vapor, carbon dioxide, and ozone, in which it is found that in the troposphere and most of the stratosphere, heating-rate errors of less than 0.2 K/day can be achieved using a total of 23 quadrature points, decreasing to less than 0.1 K/day for 32 quadrature points. It would be relatively straightforward to extend the method to include other gases.
Resumo:
Increasingly, the UK’s Private Finance Initiative has created a demand for construction companies to transfer knowledge from one organization or project to another. Knowledge transfer processes in such contexts face many challenges, due to the many resulting discontinuities in the involvement of organisations, personnel and information flow. This paper empirically identifies the barriers and enablers that hinder or enhance the transfer of knowledge in PFI contexts, drawing upon a questionnaire survey of construction firms. The main findings show that knowledge transfer processes in PFIs are hindered by time constraints, lack of trust, and policies, procedures, rules and regulations attached to the projects. Nevertheless, the processes of knowledge transfer are enhanced by emphasising the value and importance of a supportive leadership, participation/commitment from the relevant parties, and good communication between the relevant parties. The findings have considerable relevance to understanding the mechanism of knowledge transfer between organizations, projects and individuals within the PFI contexts in overcoming the barriers and enhancing the enablers. Furthermore, practitioners and managers can use the findings to efficiently design knowledge transfer frameworks that can be used to overcome the barriers encountered while enhancing the enablers to improve knowledge transfer processes.
Resumo:
The correlated k-distribution (CKD) method is widely used in the radiative transfer schemes of atmospheric models, and involves dividing the spectrum into a number of bands and then reordering the gaseous absorption coefficients within each one. The fluxes and heating rates for each band may then be computed by discretizing the reordered spectrum into of order 10 quadrature points per major gas, and performing a pseudo-monochromatic radiation calculation for each point. In this paper it is first argued that for clear-sky longwave calculations, sufficient accuracy for most applications can be achieved without the need for bands: reordering may be performed on the entire longwave spectrum. The resulting full-spectrum correlated k (FSCK) method requires significantly fewer pseudo-monochromatic calculations than standard CKD to achieve a given accuracy. The concept is first demonstrated by comparing with line-by-line calculations for an atmosphere containing only water vapor, in which it is shown that the accuracy of heating-rate calculations improves approximately in proportion to the square of the number of quadrature points. For more than around 20 points, the root-mean-squared error flattens out at around 0.015 K d−1 due to the imperfect rank correlation of absorption spectra at different pressures in the profile. The spectral overlap of m different gases is treated by considering an m-dimensional hypercube where each axis corresponds to the reordered spectrum of one of the gases. This hypercube is then divided up into a number of volumes, each approximated by a single quadrature point, such that the total number of quadrature points is slightly fewer than the sum of the number that would be required to treat each of the gases separately. The gaseous absorptions for each quadrature point are optimized such they minimize a cost function expressing the deviation of the heating rates and fluxes calculated by the FSCK method from line-by-line calculations for a number of training profiles. This approach is validated for atmospheres containing water vapor, carbon dioxide and ozone, in which it is found that in the troposphere and most of the stratosphere, heating-rate errors of less than 0.2 K d−1 can be achieved using a total of 23 quadrature points, decreasing to less than 0.1 K d−1 for 32 quadrature points. It would be relatively straightforward to extend the method to include other gases.
Resumo:
In a previous paper, we discovered a surprising spectrally-invariant relationship in shortwave spectrometer observations taken by the Atmospheric Radiation Measurement (ARM) program. The relationship suggests that the shortwave spectrum near cloud edges can be determined by a linear combination of zenith radiance spectra of the cloudy and clear regions. Here, using radiative transfer simulations, we study the sensitivity of this relationship to the properties of aerosols and clouds, to the underlying surface type, and to the finite field-of-view (FOV) of the spectrometer. Overall, the relationship is mostly sensitive to cloud properties and has little sensitivity to other factors. At visible wavelengths, the relationship primarily depends on cloud optical depth regardless of cloud phase function, thermodynamic phase and drop size. At water-absorbing wavelengths, the slope of the relationship depends primarily on cloud optical depth; the intercept, by contrast, depends primarily on cloud absorbing and scattering properties, suggesting a new retrieval method for cloud drop effective radius. These results suggest that the spectrally-invariant relationship can be used to infer cloud properties near cloud edges even with insufficient or no knowledge about spectral surface albedo and aerosol properties.
Resumo:
The rutile TiO2(110) surface has been doped with sub-monolayer metallic Cr, which oxidises and donates charge to specific surface Ti ions. X-Ray and ultra violet photoemission spectroscopy and first principles density functional theory with Hubbard U are used to assign the oxidation states of Cr and surface Ti and we find that Cr2+ forms on bridging oxygen ions and a 5-fold coordinated surface Ti atom is reduced to Ti3+ and the Cr ions readily react with oxygen (to Cr3+), which leads to depletion of surface Ti3+ 3d electrons.
Resumo:
The thoughtful construction of molecular switches has led to a gamut of supramolecular systems that can be used in molecular electronics. These include molecules based on thienylethenes, spiropyrans, fulgides, dithienylphenanthrolines, and diazafluorenes. This article reviews the recent developments made in the synthesis and characterization of all these systems, thereby allowing a comparative study to validate the viability of these switchable molecules on a nanoscale. Also, the drawbacks of each class are demonstrated and, at the same time, the remedies for further improvisation are prescribed. We have made an honest attempt to present at? exhaustive account of all the different photochromic switches developed by us hitherto.
Resumo:
In order to build up a multicomponent system able to perform useful light-induced functions, a dithienylethene-bridged heterodinuclear metal complex (Ru/Os) has been prepared. The compound was characterized and its photophysical properties studied in detail.
Resumo:
Successful knowledge transfer is an important process which requires continuous improvement in today’s knowledge-intensive economy. However, improving knowledge transfer processes represents a challenge for construction practitioners due to the complexity of knowledge acquisition, codification and sharing. Although knowledge transfer is context based, understanding the critical success factors can lead to improvements in the transfer process. This paper seeks to identify and evaluate the most significant critical factors for improving knowledge transfer processes in Public Private Partnerships/Private Finance Initiatives (PPP/PFI) projects. Drawing upon a questionnaire survey of 52 construction firms located in the UK, data is analysed using Severity Index (SI) and Coefficient of Variation (COV), to examine and identify these factors in PPP/PFI schemes. The findings suggest that a supportive leadership, participation/commitment from the relevant parties, and good communication between the relevant parties are crucial to improving knowledge transfer processes in PFI schemes. Practitioners, managers and researchers can use the findings to efficiently design performance measures for analysing and improving knowledge transfer processes.
Resumo:
Electrospinning is a technique employed to produce nanoscale to microscale sized fibres by the application of a high voltage to a spinneret containing a polymer solution. Here we examine how small angle neutron scattering data can be modelled to analyse the polymer chain conformation. We prepared 1:1 blends of deuterated and hydrogenated atactic-polystyrene fibres from solutions in N, N-Dimethylformamide and Methyl Ethyl Ketone. The fibres themselves often contain pores or voiding within the internal structure on the length scales that can interfere with scattering experiments. A model to fit the scattering data in order to obtain values for the radius of gyration of the polymer molecules within the fibres has been developed, that includes in the scattering from the voids. Using this model we find that the radius of gyration is 20% larger than in the bulk state and the chains are slightly extended parallel to the fibre axis.
Resumo:
Zn(CN)2 and Ni(CN)2 are known for exhibiting anomalous thermal expansion over a wide temperature range. The volume thermal expansion coefficient for the cubic, three dimensionally connected material, Zn(CN)2, is negative (alpha(V) = −51 10(-6) K-1) while for Ni(CN)2, a tetragonal material, the thermal expansion coefficient is negative in the two dimensionally connected sheets (alpha(a) = −7 10(-6) K-1), but the overall thermal expansion coefficient is positive (alpha(V) = 48 10(-6) K-1). We have measured the temperature dependence of phonon spectra in these compounds and analyzed them using ab initio calculations. The spectra of the two compounds show large differences that cannot be explained by simple mass renormalization of the modes involving Zn (65.38 amu) and Ni (58.69 amu) atoms. This reflects the fact that the structure and bonding are quite different in the two compounds. The calculated pressure dependence of the phonon modes and of the thermal expansion coefficient, alpha(V), are used to understand the anomalous behavior in these compounds. Our ab initio calculations indicate that phonon modes of energy approx. 2 meV are major contributors to negative thermal expansion (NTE) in both the compounds. The low-energy modes of approx.8 and 13 meV in Zn(CN)2 also contribute significantly to the NTE in Zn(CN)2 and Ni(CN)2, respectively. The measured temperature dependence of the phonon spectra has been used to estimate the total anharmonicity of both compounds. For Zn(CN)2, the temperature-dependent measurements (total anharmonicity), along with our previously reported pressure dependence of the phonon spectra (quasiharmonic), is used to separate the explicit temperature effect at constant volume (intrinsic anharmonicity).