859 resultados para Metal crystals.
Resumo:
Nanometer metal particles of tailored size (3-5 nm) and composition prepared via inverse microemulsion were encapsulated by ultrathin coatings (<2.5 nm) of inorganic porous aerogels covered with surface -OH groups. These composite materials formed metastable colloids in solvent(s), and the organic surfactant molecules were subsequently removed without leading to aggregation (the ethanolic colloid solution was shown to be stable against flocculation for at least weeks). We demonstrate that the totally inorganic-based composite colloids, after the removal of surfactant, can be anchored to conventional solid supports (gamma-alumina, carbons) upon mixing. Application of a high temperature resulted in the formation of strong covalent linkages between the colloids and the support because of the condensation of surface groups at the interface. Detailed characterizations (X-ray diffraction (XRD), pore analysis, transmission electron microscopy (TEM), CO chemisorption) and catalytic testing (butane combustion) showed that there was no significant metal aggregation from the fine metal particles individually coated with porous aerogel oxide. Most of these metal sites on the coated nanoparticles with and without support are fully accessible by small molecules hence giving extremely active metal catalysts. Thus, the product and technology described may be suitable to synthesize these precursor entities of defined metal sizes (as inks) for wash coat/impregnation applications in catalysis. The advantages of developing inorganic nanocomposite chemical precursors are also discussed.
Resumo:
The assumption that negligible work is involved in the formation of new surfaces in the machining of ductile metals, is re-examined in the light of both current Finite Element Method (FEM) simulations of cutting and modern ductile fracture mechanics. The work associated with separation criteria in FEM models is shown to be in the kJ/m2 range rather than the few J/m2 of the surface energy (surface tension) employed by Shaw in his pioneering study of 1954 following which consideration of surface work has been omitted from analyses of metal cutting. The much greater values of surface specific work are not surprising in terms of ductile fracture mechanics where kJ/m2 values of fracture toughness are typical of the ductile metals involved in machining studies. This paper shows that when even the simple Ernst–Merchant analysis is generalised to include significant surface work, many of the experimental observations for which traditional ‘plasticity and friction only’ analyses seem to have no quantitative explanation, are now given meaning. In particular, the primary shear plane angle φ becomes material-dependent. The experimental increase of φ up to a saturated level, as the uncut chip thickness is increased, is predicted. The positive intercepts found in plots of cutting force vs. depth of cut, and in plots of force resolved along the primary shear plane vs. area of shear plane, are shown to be measures of the specific surface work. It is demonstrated that neglect of these intercepts in cutting analyses is the reason why anomalously high values of shear yield stress are derived at those very small uncut chip thicknesses at which the so-called size effect becomes evident. The material toughness/strength ratio, combined with the depth of cut to form a non-dimensional parameter, is shown to control ductile cutting mechanics. The toughness/strength ratio of a given material will change with rate, temperature, and thermomechanical treatment and the influence of such changes, together with changes in depth of cut, on the character of machining is discussed. Strength or hardness alone is insufficient to describe machining. The failure of the Ernst–Merchant theory seems less to do with problems of uniqueness and the validity of minimum work, and more to do with the problem not being properly posed. The new analysis compares favourably and consistently with the wide body of experimental results available in the literature. Why considerable progress in the understanding of metal cutting has been achieved without reference to significant surface work is also discussed.
Resumo:
Previously the authors have presented both theoretical and experimental work discussing the operating mechanism of a wire rope held in a tapered socket by means of a cast resin cone. The work reported here extends the investigation to address the question of whether the same socket fabricated with white metal operates in the same manner. To date, previous investigations have compared the operational efficiency of resin and white metal in terms of both strength and/or fatigue endurance. Some other work has analysed the operation of resin sockets or specific cast metal terminations. This paper seeks to draw the results from this work together, and, in addition to a theoretical analysis, presents experimental data obtained from a direct comparison of the operation mechanism for the same sockets filled with resin or white metal. Results show that white metal terminations have a very different distribution of stresses along the length of the socket basket from resin terminations, and a smaller but still significant amount of socket draw. For both types of termination the socket draw develops high frictional gripping forces which can transfer the load from the rope to the socket. The different stress distributions mean that the consequences of termination fabrication defects may not be the same for resin and white metal terminations.
Resumo:
The perceived wisdom about thin sheet fracture is that (i) the crack propagates under mixed mode I & III giving rise to a slant through-thickness fracture profile and (ii) the fracture toughness remains constant at low thickness and eventually decreases with increasing thickness. In the present study, fracture tests performed on thin DENT plates of various thicknesses made of stainless steel, mild steel, 6082-O and NS4 aluminium alloys, brass, bronze, lead, and zinc systematically exhibit (i) mode I “bath-tub”, i.e. “cup & cup”, fracture profiles with limited shear lips and significant localized necking (more than 50% thickness reduction), (ii) a fracture toughness that linearly increases with increasing thickness (in the range of 0.5–5 mm). The different contributions to the work expended during fracture of these materials are separated based on dimensional considerations. The paper emphasises the two parts of the work spent in the fracture process zone: the necking work and the “fracture” work. Experiments show that, as expected, the work of necking per unit area linearly increases with thickness. For a typical thickness of 1 mm, both fracture and necking contributions have the same order of magnitude in most of the metals investigated. A model is developed in order to independently evaluate the work of necking, which successfully predicts the experimental values. Furthermore, it enables the fracture energy to be derived from tests performed with only one specimen thickness. In a second modelling step, the work of fracture is computed using an enhanced void growth model valid in the quasi plane stress regime. The fracture energy varies linearly with the yield stress and void spacing and is a strong function of the hardening exponent and initial void volume fraction. The coupling of the two models allows the relative contributions of necking versus fracture to be quantified with respect to (i) the two length scales involved in this problem, i.e. the void spacing and the plate thickness, and (ii) the flow properties of the material. Each term can dominate depending on the properties of the material which explains the different behaviours reported in the literature about thin plate fracture toughness and its dependence with thickness.
Resumo:
The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
We have employed a combination of experimental surface science techniques and density functional calculations to study the reduction of TiO2(110) surfaces through the doping with submonolayer transition metals. We concentrate on the role of Ti adatoms in self doping of rutile and contrast the behaviour to that of Cr. DFT+U calculations enable identification of probable adsorption structures and their spectroscopic characteristics. Adsorption of both metals leads to a broken symmetry and an asymmetric charge transfer localised around the defect site of a mixed localised/delocalised character. Charge transfer creates defect states with Ti 3d character in the band gap at similar to 1-eV binding energy. Cr adsorption, however, leads to a very large shift in the valence-band edge to higher binding energy and the creation of Cr 3d states at 2.8-eV binding energy. Low-temperature oxidation lifts the Ti-derived band-gap states and modifies the intensity of the Cr features, indicative of a change of oxidation state from Cr3+ to Cr4+. Higher temperature processing leads to a loss of Cr from the surface region, indicative of its substitution into the bulk.
Resumo:
Epitaxial ultrathin titanium dioxide films of 0.3 to similar to 7 nm thickness on a metal single crystal substrate have been investigated by high resolution vibrational and electron spectroscopies. The data complement previous morphological data provided by scanned probe microscopy and low energy electron diffraction to provide very complete characterization of this system. The thicker films display electronic structure consistent with a stoichiometric TiO2 phase. The thinner films appear nonstoichiometric due to band bending and charge transfer from the metal substrate, while work function measurements also show a marked thickness dependence. The vibrational spectroscopy shows three clear phonon bands at 368, 438, and 829 cm(-1) (at 273 K), which confirms a rutile structure. The phonon band intensity scales linearly with film thickness and shift slightly to lower frequencies with increasing temperature, in accord with results for single crystals. (c) 2007 American Institute of Physics.
Resumo:
Sub)picosecond transient absorption (TA) and time-resolved infrared (TRIR) spectra of the cluster [OS3(CO)(10-) (AcPy-MV)](2+) (the clication AcPy-MV = Acpy-MV2+ = [2-pyridylacetimine-N-(2-(1'-methyl-4,4'-bipyridine-1,1'-diium-1-yl) ethyl)] (PF6)(2)) (1(2+)) reveal that photoinduced electron transfer to the electron-accepting 4,4'-bipyridine-1,1'diium (MV2+) moiety competes with the fast relaxation of the initially populated sigmapi* excited state of the cluster to the ground state and/or cleavage of an Os-Os bond. The TA spectra of cluster 12 in acetone, obtained by irradiation into its lowest-energy absorption band, show the characteristic absorptions of the one-electron-reduced MV*(+) unit at 400 and 615 nm, in accordance with population of a charge-separated (CS) state in which a cluster-core electron has been transferred to the lowest pi* orbital of the remote MV2+ unit. This assignment is confirmed by picosecond TRIR spectra that show a large shift of the pilot highest-frequency nu(CO) band of 1(2+) by ca. +40 cm(-1), reflecting the photooxidation of the cluster core. The CS state is populated via fast (4.2 x 10(11) s(-1)) and efficient (88%) oxidative quenching of the optically populated sigmapi* excited state and decays biexponentially with lifetimes of 38 and 166 ps (1:2:1 ratio) with a complete regeneration of the parent cluster. About 12% of the cluster molecules in the sigmapi* excited state form long-lived open-core biradicals. In strongly coordinating acetonitrile, however, the cluster core-to-MV2+ electron transfer in cluster 12+ results in the irreversible formation of secondary photoproducts with a photooxidized cluster core. The photochemical behavior of the [Os-3(CO)(10)(alpha-diimine-MV)](2+) (donor-acceptor) dyad can be controlled by an externally applied electronic bias. Electrochemical one-electron reduction of the MV2+ moiety prior to the irradiation reduces its electron-accepting character to such an extent that the photoinduced electron transfer to MV*+ is no longer feasible. Instead, the irradiation of reduced cluster 1(.)+ results in the reversible formation of an open-core zwitterion, the ultimate photoproduct also observed upon irradiation of related nonsubstituted clusters [Os-3(CO)(10)(alpha-diimine)] in strongly coordinating solvents such as acetonitrile.
Resumo:
The lowest absorption band of fac-[Re(Cl)(CO)(3)(5-NO2-phen)] encompasses two close-lying MLCT transitions. The lower one is directed to LUMO, which is heavily localized on the NO2 group. The UV-vis absorption spectrum is well accounted for by TD-DFT (G03/PBEPBE1/CPCM), provided that the solvent, MeCN, is included in the calculations. Near-UV excitation of fac-[Re(Cl)(CO)(3)(5-NO2-phen)] populates a triplet metal to ligand charge-transfer excited state, (MLCT)-M-3, that was characterized by picosecond time-resolved IR spectroscopy. Large positive shifts of the v(CO) bands upon excitation (+70 cm(-1) for the A'(1) band) signify a very large charge separation between the Re(Cl)(CO)3 unit and the 5-NO2-phen ligand. Details of the excited-state character are revealed by TD-DFT calculated changes of electron density distribution. Experimental excited-state v(CO) wavenumbers agree well with those calculated by DFT. The (MLCT)-M-3 state decays with a ca. 10 ps lifetime (in MeCN) into another transient species, that was identified by TRIR and TD-DFT calculations as an intraligand (3)n pi* excited state, whereby the electron density is excited from the NO2 oxygen lone pairs to the pi* system of 5-NO2-phen. This state is short-lived, decaying to the ground state with a similar to 30 ps lifetime. The presence of an n pi* state seems to be the main factor responsible for the lack of emission and the very short lifetimes of 3 MLCT states seen in all d(6)-metal complexes of nitro-polypyridyl ligands. Localization of the excited electron density in the lowest (MLCT)-M-3 states parallels localization of the extra electron in the reduced state that is characterized by a very small negative shift of the v(CO) IR bands (-6 cm(-1) for A'(1)) but a large downward shift of the v(s)(NO2) IR band. The Re-Cl bond is unusually stable toward reduction, whereas the Cl ligand is readily substituted upon oxidation.
Resumo:
Efficient photocyclization from a low-lying triplet state is reported for a photochromic dithienylperfluorocyclopentene with Ru(bpy)(3) units attached via a phenylene linker to the thiophene rings. The ring-closure reaction in the nanosecond domain is sensitized by the metal complexes. Upon photoexcitation into the lowest Ru-to-bpy (MLCT)-M-1 state followed by intersystem crossing to emitting (MLCT)-M-3 states, photoreactive (IL)-I-3 states are populated by an efficient energy-transfer process. The involvement of these (IL)-I-3 states explains the quantum yield of the photocyclization, which is independent of the excitation wavelength but decreases strongly in the presence of dioxygen. This behavior differs substantially from the photocyclization of the nonemissive dithienylperfluorocyclopentene free ligand, which occurs from the lowest (IL)-I-1 state on a picosecond time scale and is insensitive to oxygen quenching. Cyclic voltammetric studies have also been performed to gain further insight into the energetics of the system. The very high photocyclization quantum yields, far above 0.5 in both cases, are ascribed to the strong steric repulsion between the bulky substituents on the dithienylperfluorocyclopentene bridge bearing the chelating bipyridine sites or the Ru(bpy)(3) moieties, forcing the system to adopt nearly exclusively the reactive antiparallel conformation. In contrast, replacement of both Ru(II) centers by Os(II) completely prevents the photocyclization reaction upon light excitation into the low-lying Os-to-bpy (MLCT)-M-1 state. The photoreaction can only be triggered by optical population of the higher lying (IL)-I-1 excited state of the central photochromic unit, but its yield is low due to efficient energy transfer to the luminescent lowest (MLCT)-M-3 state.
Resumo:
IR, UV-vis, and EPR spectroelectrochemistry at variable temperatures and in different solvents were applied to investigate in situ the formation of electroactive molecular chains with a nonbridged Os-Os backbone, in particular, the polymer [Os-0(bpy)(CO)(2)](n), (bpy = 2,2'-bipyridine), from a mononuclear Os(II) carbonyl precursor, [Os-II(bpy)(CO)(2)Cl-2]. The one-electron-reduced form, [Os-II(bpy(.-))(CO)(2)Cl-2](-), has been characterized spectroscopically at low temperatures. This radical anion is the key intermediate in the electrochemical propagation process responsible for the metal-metal bond formation. Unambiguous spectroscopic evidence has been gained also for the formation of [{Os-0(bpy(.-))(CO)(2)}(-)](n), the electron-rich electrocatalyst of CO2 reduction. The polymer species are fairly well soluble in butyronitrile, which is important for their potential utilization in nanoscience, for example, as conducting molecular wires. We have also shown that complete solubility is accomplished for the monocarbonyl-acetonitrile derivative of the polymer, [Os-0(bpy)(CO)(MeCN)(2)Cl](n).
Resumo:
Two complex heterometallic salts with formulae Tl-6[Fe(CN)(6)](1) (33)(NO3)(OH) (1) and [Co(bpy)(2)(CN)(2)](2){[Ag(CN)(2)](0) (5)[Fe(CN)(6)](0) (5)} 8H(2)O (2) have been synthesized and fully characterized Single crystal X-ray analyses reveal that compound 1 is comprised of discrete Tl+ cations and [Fe(CN)(6)](3-) anions together with OH- and NO3- anions Compound 2 contains [Co(bpy)(2)(CN)(2)](+) cations and {[Ag(CN)(2)][Fe(CN)(6)]}(-) anions together with eight molecules of water of crystallization Both structures form unprecedented three-dimensional supramolecular networks via non covalent interactions Another important observation is that the stereochemically active inert (lone) pair present on Tl+ plays little role in controlling the structure of 1 The water molecules in 2 play important roles in providing stability organizing a supramolecular network through hydrogen bonding In the syntheses of 1 and 2 Fe(II) is oxidized to Fe(III) and Co(II) to Co(III) respectively facilitating the formation of the salts that are obtained Both compounds exhibit photoluminescence emission in solution near the visible region.
Resumo:
Two new complex salts of the form (Bu4N)(2)[Ni(L)(2)] (1) and (Ph4P)(2)[Ni(L)(2)] (2) and four heteroleptic complexes cis-M(PPh3)(2)(L) [M = Ni(II) (3), Pd(II) (4), L = 4-CH3OC6H4SO2N=CS2] and cis-M(PPh3)(2)(L') [M = Pd(II) (5), Pt(II) (6), L' = C6H5SO2N=CS2] were prepared and characterized by elemental analyses, IR, H-1, C-13 and P-31 NMR and UV-Vis spectra, solution and solid phase conductivity measurements and X-ray crystallography. A minor product trans-Pd(PPh3)(2)(SH)(2), 4a was also obtained with the synthesis of 4. The NiS4 and MP2S2 core in the complex salts and heteroleptic complexes are in the distorted square-plane whereas in the trans complex, 4a the centrosymmetric PdS2P2 core is perforce square planar. X-ray crystallography revealed the proximity of the ortho phenyl proton of the PPh3 ligand to Pd(II) showing rare intramolecular C-H center dot center dot center dot Pd anagostic binding interactions in the palladium cis-5 and trans-4a complexes. The complex salts with sigma(rt) values similar to 10 (5) S cm (1) show semi-conductor behaviors. The palladium and platinum complexes show photoluminescence properties in solution at room temperature.
Resumo:
The topic of this work is 3d transition metals deposited on graphite. Spin-polarised density-functional calculations are used to obtain the magnetic moments of deposited adatoms and dimers. Interatomic potentials are also deduced. These are used in molecular dynamics simulations to study cluster formation and to investigate cluster morphology.