990 resultados para Human dermal fibroblasts


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We examined the effects of polyarticular juvenile idiopathic arthritis (pJIA) serum on proliferation, differentiation, mineralization, and apoptosis of human osteoblast cells (hOb) in culture. The hOb were cultured with 10% serum from active pJIA and healthy controls (CT) and were tested for DNA synthesis, alkaline phosphatase (AP) activity, osteocalcin (OC) secretion, calcium levels, caspase 3 activity, and DNA fragmentation. None of the patients had used glucocorticoids for at least 1 month before the study, or any other drug that can affect bone mineral metabolism. Human inflammatory cytokine levels (IL-6, IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70) were measured in pJIA and CT sera. Low levels of AP activity was observed in pJIA cultures compared with CT cultures (67.16 +/- 53.35 vs 100.11 +/- 50.64 mu mol p-nitrophenol/h(-1) mg(-1) protein, P=0.008). There was also a significant decrease in OC secretion (9.23 +/- 5.63 vs 12.82 +/- 7.02 ng/mg protein, P=0.012) and calcium levels (0.475 +/- 0.197 vs 0.717 +/- 0.366 mmol/l, P=0.05) in pJIA hOb cultures. No difference was observed in cell proliferation (323.56 +/- 108.23 vs 328.91 +/- 88.03 dpm/mg protein, P=0.788). Osteoblasts cultured with JIA sera showed lower levels of DNA and increased fragmentation than osteoblasts cultured with CT sera. pJIA sera showed higher IL-6 values than CT (21.44 +/- 9.31 vs 3.58 +/- 2.38 pg/ml, P<0.001), but no difference was observed related to IL-8, IL-10, IL-1 beta, TNF-alpha, and IL-12p70 between pJIA and controls. This study suggests that serum from children with pJIA inhibits differentiation, mineralization and may increase apoptosis of hOb cultures, and inflammatory cytokines such as IL-6 might be a mechanism in this find. These results may represent an alternative therapeutic target for prevention and treatment of bone loss in JIA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Insulin-like growth factor I has similar mitogenic effects to insulin, a growth factor required by most cells in culture, and it can replace insulin in serum-free formulations for some cells. Chinese Hamster Ovary cells grow well in serum-free medium with insulin and transferrin as the only exogenous growth factors. An alternative approach to addition of exogenous growth factors to serum-free medium is transfection of host cells with growth factor-encoding genes, permitting autocrine growth. Taking this approach, we constructed an IGF-I heterologous gene driven by the cytomegalovirus promoter, introduced it into Chinese Hamster Ovary cells and examined the growth characteristics of Insulin-like growth factor I-expressing clonal cells in the absence of the exogenous factor. The transfected cells secreted up to 500 ng/10(6) cells/day of mature Insulin-like growth factor I into the conditioned medium and as a result they grew autonomously in serum-free medium containing transferrin as the only added growth factor. This growth-stimulating effect, observed under both small and large scale culture conditions, was maximal since no further improvement was observed in the presence of exogenous insulin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mice expressing human cholesteryl ester transfer protein (huCETP) are more resistant to Escherichia coli bacterial wall LIPS because death rates 5 days after intraperitoneal inoculation of LIPS were higher in wild-type than in huCETP(+/-) mice, whereas all huCETP(+/+) mice remained alive. After LIPS inoculation, plasma concentrations of TNF-alpha and IL-6 increased less in huCETP(+/+) than in wild-type mice. LPS in vitro elicited lower TNF-alpha production by CETP expressing than by wild-type macrophages. In addition, TNF-alpha production by RAW 264.7 murine macrophages increased on incubation with LPS but decreased in a dose-dependent manner when human CETP was added to the medium. Human CETP in vitro enhanced the LIPS binding to plasma high-density lipoprotein/low-density lipoprotein. The liver uptake of intravenous infused C-14-LPS from Salmonella typhimurium was greater in huCETP(+/+) than in wild-type mice. Present data indicate for the first time that CETP is an endogenous component involved in the first line of defense against an exacerbated production of proinflammatory mediators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

P>Human immunodeficiency virus (HIV)-1 protease is a known target of CD8+ T cell responses, but it is the only HIV-1 protein in which no fully characterized HIV-1 protease CD4 epitopes have been identified to date. We investigated the recognition of HIV-1 protease by CD4+ T cells from 75 HIV-1-infected, protease inhibitor (PI)-treated patients, using the 5,6-carboxyfluorescein diacetate succinimidyl ester-based proliferation assay. In order to identify putative promiscuous CD4+ T cell epitopes, we used the TEPITOPE algorithm to scan the sequence of the HXB2 HIV-1 protease. Protease regions 4-23, 45-64 and 73-95 were identified; 32 sequence variants of the mentioned regions, encoding frequent PI-induced mutations and polymorphisms, were also tested. On average, each peptide bound to five of 15 tested common human leucocyte antigen D-related (HLA-DR) molecules. More than 80% of the patients displayed CD4+ as well as CD8+ T cell recognition of at least one of the protease peptides. All 35 peptides were recognized. The response was not associated with particular HLA-DR or -DQ alleles. Our results thus indicate that protease is a frequent target of CD4+ along with CD8+ proliferative T cell responses by the majority of HIV-1-infected patients under PI therapy. The frequent finding of matching CD4+ and CD8+ T cell responses to the same peptides may indicate that CD4+ T cells provide cognate T cell help for the maintenance of long-living protease-specific functional CD8+ T cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.