956 resultados para Eurovision Song Contest


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Research on molecular mechanisms of carcinogenesis plays an important role in diagnosing and treating gastric cancer. Metabolic profiling may offer the opportunity to understand the molecular mechanism of carcinogenesis and help to non-invasively identify the potential biomarkers for the early diagnosis of human gastric cancer. The aims of this study were to explore the underlying metabolic mechanisms of gastric cancer and to identify biomarkers associated with morbidity. Gas chromatography/mass spectrometry (GC/MS) was used to analyze the serum metabolites of 30 Chinese gastric cancer patients and 30 healthy controls. Diagnostic models for gastric cancer were constructed using orthogonal partial least squares discriminant analysis (OPLS-DA). Acquired metabolomic data were analyzed by the nonparametric Wilcoxon test to find serum metabolic biomarkers for gastric cancer. The OPLS-DA model showed adequate discrimination between cancer and non-cancer cohorts while the model failed to discriminate different pathological stages (I-IV) of gastric cancer patients. A total of 44 endogenous metabolites such as amino acids, organic acids, carbohydrates, fatty acids, and steroids were detected, of which 18 differential metabolites were identified with significant differences. A total of 13 variables were obtained for their greatest contribution in the discriminating OPLS-DA model [variable importance in the projection (VIP) value >1.0], among which 11 metabolites were identified using both VIP values (VIP >1) and the Wilcoxon test. These metabolites potentially revealed perturbations of glycolysis and of amino acid, fatty acid, cholesterol, and nucleotide metabolism of gastric cancer patients. These results suggest that gastric cancer serum metabolic profiling has great potential in detecting this disease and helping to understand its metabolic mechanisms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cardiovascular complications are a leading cause of mortality in patients with diabetes mellitus (DM). The present study was designed to investigate the effects of trimetazidine (TMZ), an anti-angina drug, on transient outward potassium current (Ito) remodeling in ventricular myocytes and the plasma contents of free fatty acid (FFA) and glucose in DM. Sprague-Dawley rats, 8 weeks old and weighing 200-250 g, were randomly divided into three groups of 20 animals each. The control group was injected with vehicle (1 mM citrate buffer), the DM group was injected with 65 mg/kg streptozotocin (STZ) for induction of type 1 DM, and the DM + TMZ group was injected with the same dose of STZ followed by a 4-week treatment with TMZ (60 mg·kg-1·day-1). All animals were then euthanized and their hearts excised and subjected to electrophysiological measurements or gene expression analyses. TMZ exposure significantly reversed the increased plasma FFA level in diabetic rats, but failed to change the plasma glucose level. The amplitude of Ito was significantly decreased in left ventricular myocytes from diabetic rats relative to control animals (6.25 ± 1.45 vs 20.72 ± 2.93 pA/pF at +40 mV). The DM-associated Ito reduction was attenuated by TMZ. Moreover, TMZ treatment reversed the increased expression of the channel-forming alpha subunit Kv1.4 and the decreased expression of Kv4.2 and Kv4.3 in diabetic rat hearts. These data demonstrate that TMZ can normalize, or partially normalize, the increased plasma FFA content, the reduced Ito of ventricular myocytes, and the altered expression Kv1.4, Kv4.2, and Kv4.3 in type 1 DM.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Tissue transglutaminase (type II, TG2) has long been postulated to directly promote skeletal matrix calcification and play an important role in ossification. However, limited information is available on the expression, function and modulating mechanism of TG2 during osteoblast differentiation and mineralization. To address these issues, we cultured the well-established human osteosarcoma cell line SAOS-2 with osteo-inductive conditioned medium and set up three time points (culture days 4, 7, and 14) to represent different stages of SAOS-2 differentiation. Osteoblast markers, mineralization, as well as TG2 expression and activity, were then assayed in each stage. Furthermore, we inhibited TG activity with cystamine and then checked SAOS-2 differentiation and mineralization in each stage. The results showed that during the progression of osteoblast differentiation SAOS-2 cells presented significantly high levels of osteocalcin (OC) mRNA, bone morphogenetic protein-2 (BMP-2) and collagen I, significantly high alkaline phosphatase (ALP) activity, and the increased formation of calcified matrix. With the same tendency, TG2 expression and activity were up-regulated. Furthermore, inhibition of TG activity resulted in a significant decrease of OC, collagen I, and BMP-2 mRNA and of ALP activity and mineralization. This study demonstrated that TG2 is involved in osteoblast differentiation and may play a role in the initiation and regulation of the mineralization processes. Moreover, the modulating effects of TG2 on osteoblasts may be related to BMP-2.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The phosphorylation of cardiac troponin I (cTnI) plays an important role in the contractile dysfunction associated with heart failure. Human cardiac troponin I-interacting kinase (TNNI3K) is a novel cardiac-specific functional kinase that can bind to cTnI in a yeast two-hybrid screen. The purpose of this study was to investigate whether TNNI3K can phosphorylate cTnI at specific sites and to examine whether the phosphorylation of cTnI caused by TNNI3K can regulate cardiac myofilament contractile function. Co-immunoprecipitation was performed to confirm that TNNI3K could interact with cTnI. Kinase assays further indicated that TNNI3K did not phosphorylate cTnI at Ser23/24 and Ser44, but directly phosphorylated Ser43 and Thr143 in vitro. The results obtained for adult rat cardiomyocytes also indicated that enhanced phosphorylation of cTnI at Ser43 and Thr143 correlated with rTNNI3K (rat TNNI3K) overexpression, and phosphorylation was reduced when rTNNI3K was knocked down. To determine the contractile function modulated by TNNI3K-mediated phosphorylation of cTnI, cardiomyocyte contraction was studied in adult rat ventricular myocytes. The contraction of cardiomyocytes increased with rTNNI3K overexpression and decreased with rTNNI3K knockdown. We conclude that TNNI3K may be a novel mediator of cTnI phosphorylation and contribute to the regulation of cardiac myofilament contraction function.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Multidrug resistance (MDR) poses a serious impediment to the success of chemotherapy for laryngeal cancer. To identify microRNAs and mRNAs associated with MDR of human laryngeal cancer Hep-2 cells, we developed a multidrug-resistant human laryngeal cancer subline, designated Hep-2/v, by exposing Hep-2 cells to stepwise increasing concentrations of vincristine (0.02-0.96'µM). Microarray assays were performed to compare the microRNA and mRNA expression profiles of Hep-2 and Hep-2/v cells. Compared to Hep-2 cells, Hep-2/v cells were more resistant to chemotherapy drugs (∼45-fold more resistant to vincristine, 5.1-fold more resistant to cisplatin, and 5.6-fold more resistant to 5-fluorouracil) and had a longer doubling time (42.33±1.76 vs 28.75±1.12'h, P<0.05), higher percentage of cells in G0/G1 phase (80.98±0.52 vs69.14±0.89, P<0.05), increased efflux of rhodamine 123 (95.97±0.56 vs 12.40±0.44%, P<0.01), and up-regulated MDR1 expression. A total of 7 microRNAs and 605 mRNAs were differentially expressed between the two cell types. Of the differentially expressed mRNAs identified, regulator of G-protein signaling 10, high-temperature requirement protein A1, and nuclear protein 1 were found to be the putative targets of the differentially expressed microRNAs identified. These findings may open a new avenue for clarifying the mechanisms responsible for MDR in laryngeal cancer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Anemia is a frequent complication in hemodialysis patients. Compared to conventional hemodialysis (CHD), short daily hemodialysis (sDHD) has been reported to be effective in many countries except China. The aim of the present study was to determine whether sDHD could improve anemia and quality of life (QOL) for Chinese outpatients with end-stage renal disease. Twenty-seven patients (16 males/11 females) were converted from CHD to sDHD. All laboratory values were measured before conversion (baseline), at 3 months after conversion (sDHD1), and at 6 months after conversion (sDHD2). The patient's QOL was evaluated at baseline and 6 months after conversion using the Medical Outcomes Study 36-Item Short Form Health Survey (SF-36). Hemoglobin concentration increased significantly from 107.4±7.9 g/L at baseline to 114.4±6.8 g/L (P<0.05) at sDHD1, and 118.3±8.4 g/L (P<0.001) at sDHD2 (Student paired t-test). However, the dose requirement for erythropoietin decreased from 6847.8±1057.3 U/week at baseline to 5869.6±1094.6 U/week (P<0.05) at sDHD2. Weekly stdKt/V increased significantly from 2.05±0.13 at baseline to 2.73±0.20 (P<0.001) at sDHD1, and 2.84±0.26 (P<0.001) at sDHD2. C-reactive protein decreased from baseline to sDHD1 and sDHD2, but without statistically significant differences. Physical and mental health survey scores increased in the 6 months following conversion to sDHD. sDHD may increase hemoglobin levels, decrease exogenous erythropoietin dose requirements, and improve QOL in Chinese hemodialysis patients compared to CHD. A possible mechanism for improvement of clinical outcomes may be optimized management of uremia associated with the higher efficiency of sDHD.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, electrical and structural remodeling of ventricles was examined in tachycardia-induced heart failure (HF). We studied two groups of weight-matched adult male mongrel dogs: a sham-operated control group (n=5) and a pacing group (n=5) that underwent ventricular pacing at 230 bpm for 3 weeks. Clinical symptoms of congestive HF were observed in both groups. Their hemodynamic parameters were determined and the severity of the HF was evaluated by M-mode echocardiography. Changes in heart morphology were observed by scanning electron and light microscopy. Ventricular action potential duration (APD), as well as the 50 and 90% APD were measured in both groups. All dogs exhibited clinical symptoms of congestive HF after rapid right ventricular pacing for 3 weeks. These data indicate that rapid, right ventricular pacing produces a useful experimental model of low-output HF in dogs, characterized by biventricular pump dysfunction, biventricular cardiac dilation, and non-ischemic impairment of left ventricular contractility. Electrical and structural myocardial remodeling play an essential role in congestive HF progression, and should thus be prevented.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Although 17β-estradiol (E2) deficiency has been linked to the development of osteoarthritis (OA) in middle-aged women, there are few studies relating other estrogens and estrogen metabolites (EMs) to this condition. We developed a high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) method to measure the levels of six EMs (i.e., estrone, E2, estriol, 2-hydroxyestrone, 2-hydroxyestradiol, and 16a-hydroxyestrone) in healthy pre- and postmenopausal women and women with OA. This method had a precision ranging from 1.1 to 3.1% and a detection limit ranging from 10 to 15 pg. Compared to healthy women, serum-free E2 was lower in the luteal and postmenopausal phases in women with OA, and total serum E2 was lower in postmenopausal women with OA. Moreover, compared to healthy women, total serum 2-hydroxyestradiol was higher in postmenopausal women with OA and total serum 2-hydroxyestrone was lower in both the luteal and follicular phases in women with OA. In conclusion, our HPLC-ESI-MS/MS method allowed the measurement of multiple biochemical targets in a single assay, and, given its increased cost-effectiveness, simplicity, and speed relative to previous methods, this method is suitable for clinical studies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Treatments for patients with hematologic malignancies not in remission are limited, but a few clinical studies have investigated the effects of salvaged unrelated cord blood transplantation (CBT). We retrospectively studied 19 patients with acute leukemia, 5 with myelodysplastic syndrome (MDS with refractory anemia with excess blasts [RAEB]), and 2 with non-Hodgkin's lymphoma who received 1 CBT unit ≤2 loci human leukocyte antigen (HLA)-mismatched after undergoing myeloablative conditioning regimens between July 2005 and July 2014. All of them were in non-remission before transplantation. The infused total nucleated cell (TNC) dose was 4.07 (range 2.76-6.02)×107/kg and that of CD34+ stem cells was 2.08 (range 0.99-8.65)×105/kg. All patients were engrafted with neutrophils that exceeded 0.5×109/L on median day +17 (range 14-37 days) and had platelet counts of >20×109/L on median day +35 (range 17-70 days). Sixteen patients (61.5%) experienced pre-engraftment syndrome (PES), and six (23.1%) patients progressed to acute graft-versus-host disease (GVHD). The cumulative incidence rates of II-IV acute GVHD and chronic GVHD were 50% and 26.9%, respectively. After a median follow-up of 27 months (range 5-74), 14 patients survived and 3 relapsed. The estimated 2-year overall survival (OS), disease-free survival (DFS), and non-relapse mortality (NRM) rates were 50.5%, 40.3%, and 35.2%, respectively. Salvaged CBT might be a promising modality for treating hematologic malignancies, even in patients with a high leukemia burden.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bipolar disorder (BD) is a common psychiatric mood disorder affecting more than 1-2% of the general population of different European countries. Unfortunately, there is no objective laboratory-based test to aid BD diagnosis or monitor its progression, and little is known about the molecular basis of BD. Here, we performed a comparative proteomic study to identify differentially expressed plasma proteins in various BD mood states (depressed BD, manic BD, and euthymic BD) relative to healthy controls. A total of 10 euthymic BD, 20 depressed BD, 15 manic BD, and 20 demographically matched healthy control subjects were recruited. Seven high-abundance proteins were immunodepleted in plasma samples from the 4 experimental groups, which were then subjected to proteome-wide expression profiling by two-dimensional electrophoresis and matrix-assisted laser desorption/ionization-time-of-flight/time-of-flight tandem mass spectrometry. Proteomic results were validated by immunoblotting and bioinformatically analyzed using MetaCore. From a total of 32 proteins identified with 1.5-fold changes in expression compared with healthy controls, 16 proteins were perturbed in BD independent of mood state, while 16 proteins were specifically associated with particular BD mood states. Two mood-independent differential proteins, apolipoprotein (Apo) A1 and Apo L1, suggest that BD pathophysiology may be associated with early perturbations in lipid metabolism. Moreover, down-regulation of one mood-dependent protein, carbonic anhydrase 1 (CA-1), suggests it may be involved in the pathophysiology of depressive episodes in BD. Thus, BD pathophysiology may be associated with early perturbations in lipid metabolism that are independent of mood state, while CA-1 may be involved in the pathophysiology of depressive episodes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Antioxidant activities and total phenolic content (TPC) were analyzed in ethanol extracts of 11 marigold cultivars grown in Thailand. Antioxidant activity assays performed in this study were the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) radical cation scavenging activity, ferric ion reducing antioxidant power (FRAP), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity, oxygen radical absorbance activity (ORAC), and superoxide anion radical scavenging activity (SRSA) assays. ‘Optiva Orange’ showed the best activity in the ORAC assay and in % SRSA, as well as the highest content of lutein (20.59 mg), gallic acid (25.77 mg), and quercetin (12.61 mg) per gram dry marigold petal among the 11 cultivars. Furthermore, ‘Optiva Orange’ showed the highest lutein yield per plant, as compared to other cultivars. In contrast, ‘Rodeo Gold’ showed the highest activity by ABTS testing (0.92 mmol of trolox/g dry sample), as well as an 89.90% inhibition of DPPH. Lutein content showed a positive correlation with TPC and all antioxidant activity assays. In conclusion, ‘Optiva Orange’ and ‘Rodeo Gold’ could be utilized as a good lutein source for functional food products and cosmetics.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract The effects of oil-water mixed frying (OWF) and pure-oil frying (POF) on changes in quality characteristics of soybean oil and chicken chop during six days of frying were comparatively investigated. The results showed that the changes in specific extinction coefficients, p-anisidine value, carbonyl value, viscosity and color of soybean oil were more pronounced in the case of POF, indicating that oil oxidative and polymeric degradation was retarded by OWF. Concerning fat content of chicken chop, lower (p<0.05) values were observed in the last three days in the case of OWF than POF. Meanwhile, OWF led to lower acrylamide formation in chops during the six days. Sensory evaluation showed that OWF provided chops with five attributes similar to those of chops fried by POF on the first day. As frying days increased, the decreases in scores for color, odor, flavor and overall acceptability were less in the case of OWF. In conclusion, OWF could be a worthwhile alternative for retarding oil deterioration and producing healthier and higher quality fried meat products.