Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Table de transcodage des diagnostics : VESKA (version 1979) - ICD-9-CM

Travaux effectués dans le cadre de l'étude "Case Mix" menée par l'Institut universitaire de médecine sociale et préventive de Lausanne et le Service de la santé publique et de la planification sanitaire du canton de Vaud, en collaboration avec les cantons de Berne, Fribourg, Genève, Jura, Neuchâtel, Soleure, Tessin et Valais.

DNA ja koulukirjat vielä kerran

Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.

Siihen aikaan kun DNA lukion biologian kirjoihin tuli

Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004

DNA ja Helsingin geneetikot

Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin

Current directions in DNA gel particles

A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.

Owl pellets as a source of DNA for genetic studies of small mammals.

Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.

Cytosolic sensing of extracellular self-DNA transported into monocytes by the antimicrobial peptide LL37.

The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.

Genotyping microarray for CSNB-associated genes.

PURPOSE: Congenital stationary night blindness (CSNB) is a clinically and genetically heterogeneous retinal disease. Although electroretinographic (ERG) measurements can discriminate clinical subgroups, the identification of the underlying genetic defects has been complicated for CSNB because of genetic heterogeneity, the uncertainty about the mode of inheritance, and time-consuming and costly mutation scanning and direct sequencing approaches. METHODS: To overcome these challenges and to generate a time- and cost-efficient mutation screening tool, the authors developed a CSNB genotyping microarray with arrayed primer extension (APEX) technology. To cover as many mutations as possible, a comprehensive literature search was performed, and DNA samples from a cohort of patients with CSNB were first sequenced directly in known CSNB genes. Subsequently, oligonucleotides were designed representing 126 sequence variations in RHO, CABP4, CACNA1F, CACNA2D4, GNAT1, GRM6, NYX, PDE6B, and SAG and spotted on the chip. RESULTS: Direct sequencing of genes known to be associated with CSNB in the study cohort revealed 21 mutations (12 novel and 9 previously reported). The resultant microarray containing oligonucleotides, which allow to detect 126 known and novel mutations, was 100% effective in determining the expected sequence changes in all known samples assessed. In addition, investigation of 34 patients with CSNB who were previously not genotyped revealed sequence variants in 18%, of which 15% are thought to be disease-causing mutations. CONCLUSIONS: This relatively inexpensive first-pass genetic testing device for patients with a diagnosis of CSNB will improve molecular diagnostics and genetic counseling of patients and their families and gives the opportunity to analyze whether, for example, more progressive disorders such as cone or cone-rod dystrophies underlie the same gene defects.

A nuclear defect in the 4p16 region predisposes to multiple mitochondrial DNA deletions in families with Wolfram syndrome.

Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.

A nuclear defect in the 4p16 region predisposes to multiple mitochondrial DNA deletions in families with Wolfram syndrome.

Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.

Molecular diagnostics of gliomas: the clinical perspective.

Significant progress has been made in the molecular diagnostic subtyping of brain tumors, in particular gliomas. In contrast to the classical molecular markers in this field, p53 and epidermal growth factor receptor (EGFR) status, the clinical significance of which has remained controversial, at least three important molecular markers with clinical implications have now been identified: 1p/19q codeletion, O⁶-methylguanine methyltransferase (MGMT) promoter methylation and isocitrate dehydrogenase-1 (IDH1) mutations. All three are favorable prognostic markers. 1p/19q codeletion and IDH1 mutations are also useful to support and extend the histological classification of gliomas since they are strongly linked to oligodendroglial morphology and grade II/III gliomas, as opposed to glioblastoma, respectively. MGMT promoter methylation is the only potentially predictive marker, at least for alkylating agent chemotherapy in glioblastoma. Beyond these classical markers, the increasing repertoire of anti-angiogenic agents that are currently explored within registration trials for gliomas urgently calls for efforts to identify molecular markers that predict the benefit derived from these novel treatments, too.

Colorectal cancer metastasis: the DNA repair inhibitor Dbait increases sensitivity to hyperthermia and improves efficacy of radiofrequency ablation.

PURPOSE: To assess the usefulness of combining hyperthermia with a DNA repair inhibitor (double-strand break bait [Dbait]) and its potential application to radiofrequency ablation (RFA) in a preclinical model of human colorectal cancer. MATERIALS AND METHODS: The local ethics committee of animal experimentation approved all investigations. First, the relevance was assessed by studying the survival of four human colorectal adenocarcinoma cell cultures after 1 hour of hyperthermia at 41°C or 43°C with or without Dbait. Human colon adenocarcinoma cells (HT-29) were grafted subcutaneously into nude mice (n = 111). When tumors reached approximately 500 mm(3), mice were treated with Dbait alone (n = 20), sublethal RFA (n = 21), three different Dbait schemes and sublethal RFA (n = 52), or a sham treatment (n = 18). RFA was performed to ablate the tumor center alone. To elucidate antitumor mechanisms, 39 mice were sacrificed for blinded pathologic analysis, including assessment of DNA damage, cell proliferation, and tumor necrosis. Others were monitored for tumor growth and survival. Analyses of variance and log-rank tests were used to evaluate differences. RESULTS: When associated with mild hyperthermia, Dbait induced cytotoxicity in all tested colon cancer cell lines. Sublethal RFA or Dbait treatment alone moderately improved survival (median, 40 days vs 28 days for control; P = .0005) but combination treatment significantly improved survival (median, 84 days vs 40 days for RFA alone, P = .0004), with approximately half of the animals showing complete tumor responses. Pathologic studies showed that the Dbait and RFA combination strongly enhances DNA damage and coagulation areas in tumors. CONCLUSION: Combining Dbait with RFA sensitizes the tumor periphery to mild hyperthermia and increases RFA antitumor efficacy.

DNA knots and DNA supercoiling.

Comment on: Witz G, et al. Proc Natl Acad Sci USA 2011; 108:3608-11.