Genetic diversity in wild (Sus scrofa scrofa) and domestic (Sus scrofa domestica) pigs and their hybrids based on polymorphism of a fragment of the D-loop region in the mitochondrial DNA

We examined the variation in mitochondrial DNA by sequencing the D-loop region in wild and domestic (large-white breed) pigs, in hybrids between domestic and wild pigs, and in Monteiro pigs. A D-loop fragment of approximately 330 bp was amplified by PCR. Sequencing of DNA amplicons identified haplotypes previously described as European and Asian types. Monteiro pigs and wild pigs had European haplotypes and domestic pigs had both European and Asian haplotypes. ©FUNPEC-RP.

Near full-length genome analysis of low prevalent human immunodeficiency virus type 1 subclade F1 in Sao Paulo, Brazil

Background: The genetic diversity of the human immunodeficiency virus type 1 (HIV-1) is critical to lay the groundwork for the design of successful drugs or vaccine. In this study we aimed to characterize and define the molecular prevalence of HIV-1 subclade F1 currently circulating in Sao Paulo, Brazil. Methods: A total of 36 samples were selected from 888 adult patients residing in Sao Paulo who had previously been diagnosed in two independent studies in our laboratory as being infected with subclade F1 based on pol subgenomic fragment sequencing. Proviral DNA was amplified from the purified genomic DNA of all 36 blood samples by 5 fragments overlapping PCR followed by direct sequencing. Sequence data were obtained from the 5 fragments of pure subclade F1 and phylogenetic trees were constructed and compared with previously published sequences. Subclades F1 that exhibited mosaic structure with other subtypes were omitted from any further analysis Results: Our methods of fragment amplification and sequencing confirmed that only 5 sequences inferred from pol region as subclade F1 also holds true for the genome as a whole and, thus, estimated the true prevalence at 0.56%. The results also showed a single phylogenetic cluster of the Brazilian subclade F1 along with non-Brazilian South American isolates in both subgenomic and the full-length genomes analysis with an overall intrasubtype nucleotide divergence of 6.9%. The nucleotide differences within the South American and Central African F1 strains, in the C2-C3 env, were 8.5% and 12.3%, respectively. Conclusion: All together, our findings showed a surprisingly low prevalence rate of subclade F1 in Brazil and suggest that these isolates originated in Central Africa and subsequently introduced to South America.

Evaluation of the genetic variability of orchid fleck virus by single-strand conformational polymorphism analysis and nucleotide sequencing of a fragment from the nucleocapsid gene

The variability of a fragment of the nucleocapsid gene of orchid fleck virus (OFV) was investigated by single-strand conformational polymorphism (SSCP) analysis and nucleotide sequencing. Forty-eight samples of 18 genera of orchids were collected from Brazil, Costa Rica and Australia. The SSCP analysis yielded six different band patterns, and phylogenetic analysis based on the nucleotide fragment sequence obtained in this work and six available in GenBank showed two different groups, one with isolates 023Germany and So-Japan, and other with the rest of the isolates. None of the analyses showed geographic correlation among the Brazilian strains. The data obtained in this study showed a low genetic variation in this region of the genome; the d(N)/d(S) ratio of 0.251-0.405 demonstrated a negative selective pressure that maintains the stability of the analyzed fragments.

Analysis of the genetic polymorphism of Paracoccidioides brasiliensis and Paracoccidioides cerebriformis "Moore" by random amplified polymorphic DNA (RAPD) and 28S ribosomal DNA sequencing: Paracoccidioides cerebriformis revisited

Our purpose was to compare the genetic polymorphism of six samples of P. brasiliensis (113, 339, BAT, T1F1, T3B6, T5LN1), with four samples of P. cerebriformis (735, 741, 750, 361) from the Mycological Laboratory of the Instituto de Medicina Tropical de São Paulo, using Random Amplified Polymorphic DNA Analysis (RAPD). RAPD profiles clearly segregated P. brasiliensis and P. cerebriformis isolates. However, the variation on band patterns among P. cerebriformis isolates was high. Sequencing of the 28S rDNA gene showed nucleotide conservancy among P. cerebriformis isolates, providing basis for taxonomical grouping, and disclosing high divergence to P. brasiliensis supporting that they are in fact two distinct species. Moreover, DNA sequence suggests that P. cerebriformis belongs in fact to the Aspergillus genus.

Linkage disequilibrium between a melanin-based colour polymorphism and tail length in the barn owl

A linkage disequilibrium between sexually selected and life history traits can be explained by three mutually non-exclusive mechanisms. Genes coding for two traits may be located close on the same chromosome, genes responsible for variation in one of the trait may pleiotropically alter the other, and non-random pairing with respect to two traits may generate a non-physical linkage disequilibrium between their genes. Knowledge of which of these three mechanisms is responsible for a covariation between two traits is of interest to understand why differently ornamented individuals differ in several phenotypic aspects. In Switzerland, barn owls Tyto alba mate randomly with respect to a colour polymorphism generating a large range of variants between reddish-brown and white, males being lighter coloured than females. Several studies have shown that plumage coloration is not neutral with respect to some life history components. To test whether coloration is genetically associated with body size, partial cross-fostering experiments were performed by exchanging some hatchlings between nests. These experiments showed that darker biological fathers produce longer-tailed offspring. This sex-specific pattern is consistent with the hypothesis of non-physical linkage disequilibrium. In line with this hypothesis, darker coloured males were mated with longer-tailed females, whereas female coloration was not associated with tail length of their mate. The finding that dark nestlings had a longer tail than their pale siblings also supports the physical linkage and pleiotropy hypotheses. Therefore, non-random pairing can generate or strengthen a genetic covariation between a secondary sexual character and a morphological trait.

Single-nucleotide polymorphism analysis of GH, GHR, and IGF-1 genes in minipigs

Tibetan (TB) and Bama (BM) miniature pigs are two popular pig breeds that are used as experimental animals in China due to their small body size. Here, we analyzed single-nucleotide polymorphisms (SNPs) in gene fragments that are closely related to growth traits [growth hormone (GH), growth hormone receptor (GHR), and insulin-like growth factor (IGF)-1)] in these pig breeds and a large white (LW) control pig breed. On the basis of the analysis of 100 BMs, 108 TBs, and 50 LWs, the polymorphic distribution levels of GH, GHR, and IGF-1 were significantly different among these three pig breeds. According to correlation analyses between SNPs and five growth traits - body weight (BW), body length (BL), withers height (WH), chest circumference (CC), and abdomen circumference (AC) - three SNP loci in BMs and four SNP loci in TBs significantly affected growth traits. Three SNP sites in BMs and four SNP sites in TBs significantly affected growth traits. SNPs located in the GH gene fragment significantly affected BL and CC at locus 12 and BL at locus 45 in BMs, and also BW, WH, CC, and AC at locus 45 and WH and CC at locus 93 in TBs. One SNP at locus 85 in the BM GHR gene fragment significantly affected all growth traits. All indices were significantly reduced with a mixture of alleles at locus 85. These results provide more information regarding the genetic background of these minipig species and indicate useful selection markers for pig breeding programs.

Detection of somaclonal variation during cocoa somatic embryogenesis characterised using cleaved amplified polymorphic sequence and the new freeware Artbio

The scarcity and stochastic nature of genetic mutations presents a significant challenge for scientists seeking to characterise de novo mutation frequency at specific loci. Such mutations can be particularly numerous during regeneration of plants from in vitro culture and can undermine the value of germplasm conservation efforts. We used cleaved amplified polymorphic sequence (CAPS) analysis to characterise new mutations amongst a clonal population of cocoa plants regenerated via a somatic embryogenesis protocol used previously for cocoa cryopreservation. Efficacy of the CAPS system for mutation detection was greatly improved after an ‘a priori’ in silico screen of reference target sequences for actual and potential restriction enzyme recognition sites using a new freely available software called Artbio. Artbio surveys known sequences for existing restriction enzyme recognition sites but also identifies all single nucleotide polymorphism (SNP) deviations from such motifs. Using this software, we performed an in silico screen of seven loci for restriction sites and their potential mutant SNP variants that were possible from 21 restriction enzymes. The four most informative locus-enzyme combinations were then used to survey the regenerant populations for de novo mutants. We characterised the pattern of point mutations and, using the outputs of Artbio, calculated the ratio of base substitution in 114 somatic embryo-derived cocoa regenerants originating from two explant genotypes. We found 49 polymorphisms, comprising 26.3% of the samples screened, with an inferred rate of 2.8 × 10−3 substitutions/screened base. This elevated rate is of a similar order of magnitude to previous reports of de novo microsatellite length mutations arising in the crop and suggests caution should be exercised when applying somatic embryogenesis for the conservation of plant germplasm.

Mutations within the FGF5 gene are associated with hair length in cats

Hereditary hair length variability in mice and dogs is caused by mutations within the fibroblast growth factor 5 (FGF5) gene. The aim of this study was to evaluate the feline FGF5 orthologue as a functional candidate gene for the long hair phenotype in cats, which is recessive to short hair. We amplified the feline FGF5 cDNA and characterised two alternatively spliced transcripts by RT-PCR. Comparative cDNA and genomic DNA sequencing of long- and short-haired cats revealed four non-synonymous polymorphisms in the FGF5 coding sequence. A missense mutation (AM412646:c.194C>A) was found in the homozygous state in 25 long-haired Somali, Persian, Maine Coon, Ragdoll and crossbred cats. Fifty-five short-haired cats had zero or one copy of this allele. Additionally, we found perfect co-segregation of the c.194C>A mutation within two independent pedigrees segregating for hair length. A second FGF5 exon 1 missense mutation (AM412646:c.182T>A) was found exclusively in long-haired Norwegian Forest cats. The c.182T>A mutation probably represents a second FGF5 mutation responsible for long hair in cats. In addition to the c.194C>A mutation, a frameshift mutation (AM412646:c.474delT) was found with a high frequency in the long-haired Maine Coon breed. Finally, a missense mutation (AM412646:c.475A>C) was also associated with the long-haired phenotype in some breeds. However, as one short-haired cat was homozygous for this polymorphism, it is unlikely that it has a functional role in the determination of hair length.

Phylogenetic assessment of length variation at a microsatellite locus

Sixty-six haplotypes at a locus containing a simple dinucleotide (CA)n microsatellite repeat were isolated by PCR–single-strand conformational polymorphism from populations of the horseshoe crab Limulus polyphemus. These haplotypes were sequenced to assess nucleotide variation directly. Thirty-four distinct sequences (alleles) were identified in a region 570 bp long that included the microsatellite motif. In the repeat region itself, CA-number varied in integer values from 5 to 11 across alleles, except that a (CA)8 class was not observed. Differences among alleles were due also to polymorphisms at 22 sites in regions immediately flanking the microsatellite repeats. Nucleotide substitutions in these regions were used to estimate phylogenetic relationships among alleles, and the gene phylogeny was used to trace the evolution of length variation and CA repeat numbers. A low correlation between size variation and genealogical relationships among alleles suggests that absolute fragment size (as normally scored in microsatellite assays) is an unreliable indicator of historical affinities among alleles. This finding on the molecular fine structure of microsatellite variation suggests the need for caution in the use of repeat counts at microsatellite loci as secure indicators of allelic relationships.

Genetic Predictors Of Long-term Response To Growth Hormone (gh) Therapy In Children With Gh Deficiency And Turner Syndrome: The Influence Of A Socs2 Polymorphism.

There is great interindividual variability in the response to GH therapy. Ascertaining genetic factors can improve the accuracy of growth response predictions. Suppressor of cytokine signaling (SOCS)-2 is an intracellular negative regulator of GH receptor (GHR) signaling. The objective of the study was to assess the influence of a SOCS2 polymorphism (rs3782415) and its interactive effect with GHR exon 3 and -202 A/C IGFBP3 (rs2854744) polymorphisms on adult height of patients treated with recombinant human GH (rhGH). Genotypes were correlated with adult height data of 65 Turner syndrome (TS) and 47 GH deficiency (GHD) patients treated with rhGH, by multiple linear regressions. Generalized multifactor dimensionality reduction was used to evaluate gene-gene interactions. Baseline clinical data were indistinguishable among patients with different genotypes. Adult height SD scores of patients with at least one SOCS2 single-nucleotide polymorphism rs3782415-C were 0.7 higher than those homozygous for the T allele (P < .001). SOCS2 (P = .003), GHR-exon 3 (P= .016) and -202 A/C IGFBP3 (P = .013) polymorphisms, together with clinical factors accounted for 58% of the variability in adult height and 82% of the total height SD score gain. Patients harboring any two negative genotypes in these three different loci (homozygosity for SOCS2 T allele; the GHR exon 3 full-length allele and/or the -202C-IGFBP3 allele) were more likely to achieve an adult height at the lower quartile (odds ratio of 13.3; 95% confidence interval of 3.2-54.2, P = .0001). The SOCS2 polymorphism (rs3782415) has an influence on the adult height of children with TS and GHD after long-term rhGH therapy. Polymorphisms located in GHR, IGFBP3, and SOCS2 loci have an influence on the growth outcomes of TS and GHD patients treated with rhGH. The use of these genetic markers could identify among rhGH-treated patients those who are genetically predisposed to have less favorable outcomes.

Supramolecular polymorphism of DNA in non-cationic L(alpha) lipid phases

The structure of a complex between hydrated DNA and a non-cationic lipid is studied, including its phase diagram. The complex is spontaneously formed by adding DNA fragments (ca. 150 base pairs in length) to non-cationic lipids and water. The self-assembly process often leads to highly ordered structures. The structures were studied by combining X-ray scattering, fluorescence and polarized microscopy, as well as freeze-fracture experiments with transmission electron microscopy. We observe a significant increase of the smectic order as DNA is incorporated into the water layers of the lamellar host phase, and stabilization of single phase domains for large amounts of DNA. The effect of confinement on DNA ordering is investigated by varying the water content, following three dilution lines. A rich polymorphism is found, ranging from weakly correlated DNA-DNA in-plane organizations to highly ordered structures, where transmembrane correlations lead to the formation of columnar rectangular and columnar hexagonal superlattices of nucleotides embedded between lipid lamellae. From these observations, we suggest that addition of DNA to the lamellar phase significantly restricts membrane fluctuations above a certain concentration and helps the formation of the lipoplex. The alteration of membrane steric interactions, together with the appearance of interfacial interactions between membranes and DNA molecules may be a relevant mechanism for the emergence of highly ordered structures in the concentrated regime.

Wing polymorphism and dispersal of Scaptocoris carvalhoi (Hemiptera : Cydnidae)

Functional wing polymorphism is commonly observed it) insects, and it may confer an important adaptive value to populations that bear this trait, because it allows dispersal and the location to more favorable habitats for their survival and reproduction. According to the oogenesis-flight syndrome theory, such wing polymorphism may imply differences in the locomotion Capacity of individuals, which is a factor induced by adverse environmental conditions during muscle development in immatures. Scaptocoris carvalhoi Becker (Hemiptera: Cydnidae) is an important agriculture pest in Brazil, and it has burrowing habits. The adults swarm in the beginning of the rainy season after a prolonged drought period in the Brazilian cerrado region. In these swarms, part of the population leaves the soil, performing long flights until locations with more abundant vegetation. In this study, we characterized wing polymorphism in S. carvalhoi, this being the first description in a species of Cydnidae. Brachypterous and macropterous males and females were observed, which showed positive and significant correlations between body length and hindwing length. Macropterous individuals demonstrated greater locomotion capacity than brachypterous individuals. In addition, only long-winged adults could fly, showing wing mobility and flight reaction. The increased number of macropterous individuals inside the soil during the swarming season and in the beginning of the rainy period suggests that wing polymorphism in this population occurs in seasonal cycles and that factors related to the scarcity of rains influence the development of immatures and the formation of polymorphic adults.

Biotype stability of Candida albicans isolates after culture storage determined by randomly amplified polymorphic DNA and phenotypical methods

P>Typing methods to evaluate isolates in relation to their phenotypical and molecular characteristics are essential in epidemiological studies. In this study, Candida albicans biotypes were determined before and after storage in order to verify their stability. Twenty C. albicans isolates were typed by Randomly Amplified Polymorphic DNA (RAPD), production of phospholipase and proteinase exoenzymes (enzymotyping) and morphotyping before and after 180 days of storage in Sabouraud dextrose agar (SDA) and sterilised distilled water. Before the storage, 19 RAPD patterns, two enzymotypes and eight morphotypes were identified. The fragment patterns obtained by RAPD, on the one hand, were not significantly altered after storage. On the other hand, the majority of the isolates changed their enzymotype and morphotype after storage. RAPD typing provided the better discriminatory index (DI) among isolates (DI = 0.995) and maintained the profile identified, thereby confirming its utility in epidemiological surveys. Based on the low reproducibility observed after storage in SDA and distilled water by morphotyping (DI = 0.853) and enzymotyping (DI = 0.521), the use of these techniques is not recommended on stored isolates.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).