995 resultados para AMPLIFIED ANALYSIS
Resumo:
Aims: This study has compared the tissue expression of the p53 tumour suppressor protein and DNA repair proteins APE1, hMSH2 and ERCC1 in normal, dysplastic and malignant lip epithelium. Methods and results: Morphological analysis and immunohistochemistry were performed on archived specimens of normal lip mucosa (n = 15), actinic cheilitis (AC) (n = 30), and lip squamous cell carcinoma (LSCC) (n = 27). AC samples were classified morphologically according to the severity of epithelial dysplasia and risk of malignant transformation. LSCC samples were morphologically staged according to WHO and invasive front grading (IFG) criteria. Differences between groups and morphological stages were determined by bivariate statistical analysis. Progressive increases in the percentage of epithelial cells expressing p53 and APE1 were associated with increases in morphological malignancy from normal lip mucosa to LSCC. There was also a significant reduction in epithelial cells expressing hMSH2 and ERCC1 proteins in the AC and LSCC groups. A higher percentage of malignant cells expressing APE1 was found in samples with an aggressive morphological IFG grade. Conclusions: Our data showed that epithelial cells from premalignant to malignant lip disease exhibited changes in the expression of p53, APE1, hMSH2 and ERCC1 proteins; these molecular change might contribute to lip carcinogenesis.
Resumo:
Background The objective of this study was to evaluate the early results of the laparoscopic interposition of a segment of ileum associated with a sleeve gastrectomy (LII-SG) in order to treat patients with type 2 diabetes mellitus (T2DM) and BMI <35. Data regarding morbidly obese diabetic patients subjected to surgery has consistently been validated. To date, there is scarce information about morbidity and mortality related to the surgical treatment of a ""true"" typical diabetic population with BMI <35. Methods The procedures were performed in 454 patients (322 male, 132 female). Mean age was 53.6 +/- 8 years (range = 27-75). Mean BMI was 29.7 +/- 3.6 kg/m(2) (range = 19-34.8). All patients had the diagnosis of T2DM for at least 3 years. Insulin therapy was used by 45.6% of patients. Mean duration of T2DM was 10.8 +/- 5.9 years (range = 3-35). Mean hemoglobin A(1c) was 8.8 +/- 1.9%. Dyslipidemia was observed in 78.4%, hypertension in 64.8%, nephropathy in 28.6%, retinopathy in 32.6%, neuropathy in 34.6%, and coronary heart disease in 13%. Results There was no conversion to open surgery. All patients were evaluated postoperatively. Mortality was 0.4%. There were 29 major complications (6.4%) in 22 patients (4.8%) and 51 minor complications (11.2%). Reoperations were performed on 8 patients (1.7%). Twenty patients (4.4%) were readmitted to the hospital. Mean postoperative BMI was 25.8 +/- 3.5 kg/m(2). Mean fasting plasma glucose decreased from 198 +/- 69 to 128 +/- 67 mg/dl and mean postprandial plasma glucose decreased from 262 +/- 101 to 136 +/- 43 mg/dl. Conclusions The laparoscopic ileal interposition associated with a sleeve gastrectomy was considered a safe operation with low rates of morbidity and mortality in a diabetic population with BMI < 35. An early control of postprandial glycemia was observed.
Resumo:
Background: Percutaneous transluminal angioplasty has been used with increasing frequency in the treatment of infrainguinal arterial occlusive disease. This meta-analysis aimed to assess the middle-term outcomes after crural angioplasty in patients with chronic critical limb ischemia and compare results with a meta-analysis of popliteal-to-distal vein bypass graft. Methods: Data were retrieved from 30 articles published from 1990 through 2006 (63% of articles published between 2000 and 2006). All studies used survival analysis, reported a 12-month cumulative rate of patency or limb salvage, and included at least 15 infrapopliteal angioplasties. The outcome measures were immediate technical success, primary and secondary patency, limb salvage, and patient survival. Data from life-tables, survival curves, and texts were used. Results. The pooled estimate of success was 89.0% +/- 2.2% for immediate technical result. Results at 1 and 36 months were 77.4% +/- 4.1% and 48.6% +/- 8.0% for primary patency, 83.3% +/- 1.4% and 62.9% +/- 11.0% for secondary patency, 93.4% +/- 2.3% and 82.4% +/- 3.4% for limb salvage, and 98.3% +/- 0.7% and 68.4% +/- 5.5% for patient survival, respectively. Studies with >75% of the limbs with tissue loss fared worse than their respective comparative subgroup for technical success and patency but not for limb salvage or survival. No publication bias was detected. Conclusion: The technical success and subsequent durability of crural angioplasty are limited compared with bypass surgery, but the clinical benefit is acceptable because limb salvage rates are equivalent to bypass surgery. Further studies are necessary to determine the proper role of infrapopliteal angioplasty.
Resumo:
Introduction: mild head trauma (MHT) is defined as a transient neurological deficit after trauma with a history of impairment or loss of consciousness lasting less than 15 min and/or posttraumatic amnesia, and a Glasgow Coma Scale between 13 and 15 on hospital admission. We evaluated 50 MHT patients 18 months after the trauma, addressing signs and symptoms of post-concussion syndrome, quality of life and the presence of anxiety and depression. We correlate those findings with the S100B protein levels and cranial CT scan performed at hospital admission after the trauma. Method: patients were asked to fill out questionnaires to assess quality of life (SF36), anxiety and depression (HADS), and signs and symptoms of post-concussion syndrome. For the control group, we asked the patient`s household members, who had no history of head trauma of any type, to answer the same questionnaires for comparison. Results: total quality of life index for patients with MHT was 58.16 (+/-5), lower than the 73.47 (+/-4) presented by the control group. Twenty patients (55.2%) and four (11.1%) controls were depressed. Seventeen patients (47.2%) presented anxiety, whereas only eight (22.2%) controls were considered anxious. Victims of MHT complained more frequently of loss of balance, dry mouth, pain in the arms, loss of memory and dizziness than their respective controls (p < 0.05). We found no correlation between the presence of these signs and symptoms, quality of life, presence of anxiety and depression with S100B protein levels or with presence of injury in the cranial CT performed at hospital admission. Conclusion: MHT is associated with a higher incidence of post-concussion syndrome symptoms, lower quality of life and anxiety than their respective controls even 18 months after the trauma. (C) 2007 Elsevier Ltd. All rights reserved.
Resumo:
To evaluate differential gene expression in penile tissue after treatment with the phosphodiesterase 5 (PDE5) inhibitor tadalafil, as of the three clinically available PDE5 inhibitors (sildenafil, tadalafil, and vardenafil) used for the treatment of erectile dysfunction (ED), tadalafil has a long half-life and low incidence of side-effects. In all, 32 adult rats were divided into two groups. The control group received 0.5 mL of drinking water alone, while the tadalafil group was treated with tadalafil at a dose of 0.27 mg/kg. At 4 h after treatment with water or tadalafil the rats were killed and the penile tissue was removed. The total RNA was isolated from the penile tissue from both groups and differentially expressed genes were identified by cDNA microarray analysis. To validate the expression data from the microarray analysis, quantitative real-time polymerase chain reaction (PCR) and immunohistochemistry were used. In all, 153 genes were differentially expressed between the control group and the tadalafil group. We validated the microarray results by quantitative PCR for the insulin-like growth factor binding protein 6 (IGFBP-6) gene and the neuronal calcium sensor 1 (NCS-1) gene, both of which were up-regulated in the tadalafil group, and for the natriuretic peptide receptor 1 (NPR-1) gene that was down-regulated in this group. Immunohistochemistry showed localization of the NCS-1 protein in sinusoid trabeculae of the corpus cavernosum in control and tadalafil-treated rats. There was differential expression in 153 genes after tadalafil treatment. Some of these genes such as IGFBP-6, NPR-1 and NCS-1, might result in new targets in the treatment of ED.
Resumo:
Aim: To evaluate percutaneous cryotherapy as a primary treatment option for prostate cancer, comparing different risk groups. Patients and Methods: Forty-seven prostate cryoablation procedures were performed on 44 patients. Patients median age was 70.9, and average pretreatment PSA of 13.8 ng/dl. Patients were divided into low-risk (13 patients), high-risk (24 patients) and radiation failure patients (7 patients). The follow-up period ranged from 18 to 60 months (median 41 months). Results: In the low-risk group, we found after 12 and 24 months of follow-up, 92 and 86% of patients free of PSA relapse (PSA < 1 ng/ml), respectively. In the high-risk group, the PSA failure was 39 and 52.9%. For the radiation failure group, 86 and 71.4% of patients had PSA below 1 ng/dl. At 48 months of follow-up, 80% of the low-risk patients, 42.8% of the high-risk group and 71.4% of the radiation failure group were free of PSA relapse. The complication rates were low, with 13% of urinary incontinence and no cases of rectal injury. Conclusion: Prostate cryoablation is a viable and promising minimally invasive alternative for localized or locally advanced prostate cancer patients. Copyright (c) 2008 S. Karger AG, Basel.
Resumo:
The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.
Resumo:
An important consideration in the development of mathematical models for dynamic simulation, is the identification of the appropriate mathematical structure. By building models with an efficient structure which is devoid of redundancy, it is possible to create simple, accurate and functional models. This leads not only to efficient simulation, but to a deeper understanding of the important dynamic relationships within the process. In this paper, a method is proposed for systematic model development for startup and shutdown simulation which is based on the identification of the essential process structure. The key tool in this analysis is the method of nonlinear perturbations for structural identification and model reduction. Starting from a detailed mathematical process description both singular and regular structural perturbations are detected. These techniques are then used to give insight into the system structure and where appropriate to eliminate superfluous model equations or reduce them to other forms. This process retains the ability to interpret the reduced order model in terms of the physico-chemical phenomena. Using this model reduction technique it is possible to attribute observable dynamics to particular unit operations within the process. This relationship then highlights the unit operations which must be accurately modelled in order to develop a robust plant model. The technique generates detailed insight into the dynamic structure of the models providing a basis for system re-design and dynamic analysis. The technique is illustrated on the modelling for an evaporator startup. Copyright (C) 1996 Elsevier Science Ltd
Resumo:
In this second paper, the three structural measures which have been developed are used in the modelling of a three stage centrifugal synthesis gas compressor. The goal of this case study is to determine the essential mathematical structure which must be incorporated into the compressor model to accurately model the shutdown of this system. A simple, accurate and functional model of the system is created via three structural measures. It was found that the model can be correctly reduced into its basic modes and that the order of the differential system can be reduced from 51(st) to 20(th). Of the 31 differential equational 21 reduce to algebraic relations, 8 become constants and 2 can be deleted thereby increasing the algebraic set from 70 to 91 equations. An interpretation is also obtained as to which physical phenomena are dominating the dynamics of the compressor add whether the compressor will enter surge during the shutdown. Comparisons of the reduced model performance against the full model are given, showing the accuracy and applicability of the approach. Copyright (C) 1996 Elsevier Science Ltd
Resumo:
Background: The use of synthetic mesh for abdominal wall closure after removal of the rectus abdominis is established but not standardised. This study compares two forms of mesh fixation: a simple suture, which fixes the mesh to the edges of the defect on the anterior rectus abdominis fascia; and total fixation, which incorporates the fasciae of the internal oblique, external oblique and transverse muscles in the suture, anchoring the mesh in the position of the removed muscle. Method: A total of 16 fresh cadavers were dissected. Two sutures were compared: simple and total. Three different sites were analysed: 5 cm above, 5 cm below and at the level of the umbilicus. The two sutures compared were tested in each region using a standardised technique. All sutures were performed with nylon 0, perpendicular to the linea alba. Each suture was secured to a dynamometer, which was pulled perpendicularly towards the midline until the rupture of the aponeurosis. `Rupture resistance` was measured in kilogram force. The mean among the groups was compared using the paired Student`s t-test to a significance level of 1% (p < 0.01). Results: The mean rupture resistance of the total suture was 160% higher than that of the simple suture. Conclusion: The total suture includes the external oblique, internal oblique and transverse fasciae, which are multi-directional, and creates a much higher resistance when compared with the simple suture. Total suture may reduce the incidence of bulging and hernias of the abdominal wall after harvesting the rectus abdominis muscle, but comparative clinical studies are necessary. (C) 2010 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Resumo:
The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
This study aims to review the experience, at an institution, with patients who suffered electrical burns and study the peculiar characteristics of this type of burn as well as its complications and epidemiological aspects. The study includes medical records of patients with electrical burns who were admitted to the Burn Unit of Hospital das Clinicas in Sao Paulo, Brazil, from November 2001 to October 2006. They were classified into four categories: high voltage (>= 1000 V), low voltage (<1000 V), `flash burn` (in which there is no electrical current flow through the body of the patient) and burns caused by lightning. The complications were more severe and common in the high-voltage group, while longer hospital stays and more complex surgical procedures due to the greater depth of burns were also observed in this group. High-voltage burns are mainly labour-/occupation-related. The majority of the patients were young men at the beginning of their professional lives. This factor generates an important socio-economic impact due to the high incidence of sequelae, resulting in amputations, rendering them unable to maintain their occupations. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.
Resumo:
Protrusion of the abdominal wall secondary to abdominoplasty may occur in patients with weakness of the aponeurotic structures. The anterior layer of the rectus abdominis muscle consists of fibers that are transverse rather than vertical. Based on this anatomical feature, vertical sutures are suggested for the correction of diastasis recti, since they include a greater amount of fascial fibers and thus would be more resistant to tensile strength than horizontal ones. The anterior layers of the rectus abdominis muscles of 15 fresh cadavers were dissected. Two vertical lines were marked on each side of the linea alba, corresponding to the site where plication is usually performed in abdominoplasties. Three abdominal levels were evaluated: the supraumbilical, umbilical, and infraumbilical levels. A simple suture was placed in the vertical direction in one group and in the horizontal direction in the other group, at each of the three levels previously described. These sutures were connected to a dynamometer, which was pulled medially toward the linea alba until rupture of the aponeurosis occurred. The mean strength required to rupture the aponeurotic structures in which the vertical sutures had been placed was greater than for the horizontal ones (p < 0.0001). The vertical suture of the rectus abdominis sheaths was stronger than the horizontal suture because of the more transversal arrangement of its aponeurotic fibers. Thus, routine use of the vertical suture in plications of the aponeurosis of the rectus abdominis muscles is suggested.