An overall statistic for testing symmetry in social interactions

The present work focuses the attention on the skew-symmetry index as a measure of social reciprocity. This index is based on the correspondence between the amount of behaviour that each individual addresses to its partners and what it receives from them in return. Although the skew-symmetry index enables researchers to describe social groups, statistical inferential tests are required. The main aim of the present study is to propose an overall statistical technique for testing symmetry in experimental conditions, calculating the skew-symmetry statistic (Φ) at group level. Sampling distributions for the skew- symmetry statistic have been estimated by means of a Monte Carlo simulation in order to allow researchers to make statistical decisions. Furthermore, this study will allow researchers to choose the optimal experimental conditions for carrying out their research, as the power of the statistical test has been estimated. This statistical test could be used in experimental social psychology studies in which researchers may control the group size and the number of interactions within dyads.

Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

Degradação de 14C-atrazina em solo sob condições semicontroladas

Objetivou-se neste trabalho, avaliar a mineralização e a formação de resíduos extraível e não-extraível de 14C-atrazina em um solo intensivamente utilizado para fins agrícolas no Estado de São Paulo. Atrazina radiomarcada foi aplicada (5 L ha-1 ou 2 mg kg-1 de i.a.) em um Latossolo Vermelho-Escuro, álico, A moderado, textura média. Frascos erlenmeyer contendo 200 g (peso seco) do solo assim preparado e com umidade ajustada para 2/3 da capacidade de campo foram enterrados na Estação Experimental de Lisímetros do CENA-USP, onde se iniciou, ao mesmo tempo, uma plantação de milho. O 14CO2 desprendido foi avaliado a cada 15 dias, durante 150 dias, e atingiu, no final desse período de incubação, 36% da atividade total aplicada, e meia-vida de 168 dias. Os resíduos formados no solo foram determinados, em termos de dessorção, com o uso de cloreto de cálcio, e, em termos de extração, com o sistema-solvente acetonitrila/água (80:20); os resíduos não-extraíveis foram avaliados por combustão. Durante o período de incubação, os resíduos extraíveis diminuíram para 1/3, enquanto os resíduos ligados (não-extraíveis) permaneceram ao redor de 34%. Os metabólitos foram identificados por cromatografia em camada delgada, e foram detectadas, nas frações dessorvidas, hidroxiatrazina (44%), desisopropilatrazina (3,28%) e atrazina (52,72%) e nas frações extraídas, hidroxiatrazina (16,22%), desisopropilatrazina (2,25%), desetilatrazina (2,24%) e atrazina (79,29%). Conclui-se que a mineralização ocorreu somente na fração de resíduos extraíveis e foi favorecida pelas condições de incubação, em que o principal fator foi a variação de temperatura.

Navigator-gated free-breathing 3D balanced FFE projection renal MRA: Comparison with contrast-enhanced breath-hold 3D MRA in a swine model.

A cardiac-triggered, free-breathing, 3D balanced FFE projection renal MR angiography (MRA) technique with a 2D pencil beam aortic labeling pulse for selective aortic spin tagging was developed. For respiratory motion artifact suppression during free breathing, a prospective real-time navigator was implemented for renal MRA. Images obtained with the new approach were compared with standard contrast-enhanced (CE) 3D breath-hold MRA in seven swine. Signal properties and vessel visualization were analyzed. With the presented technique, high-resolution, high-contrast renal projection MRA with superior vessel length visualization (including a greater visible number of distal branches of the renal arteries) compared to standard breath-hold CE-MRA was obtained. The present results warrant clinical studies in patients with renal artery disease.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Biomedical risk assessment as an aid for smoking cessation.

BACKGROUND: A possible strategy for increasing smoking cessation rates could be to provide smokers who have contact with healthcare systems with feedback on the biomedical or potential future effects of smoking, e.g. measurement of exhaled carbon monoxide (CO), lung function, or genetic susceptibility to lung cancer. OBJECTIVES: To determine the efficacy of biomedical risk assessment provided in addition to various levels of counselling, as a contributing aid to smoking cessation. SEARCH METHODS: For the most recent update, we searched the Cochrane Collaboration Tobacco Addiction Group Specialized Register in July 2012 for studies added since the last update in 2009. SELECTION CRITERIA: Inclusion criteria were: a randomized controlled trial design; subjects participating in smoking cessation interventions; interventions based on a biomedical test to increase motivation to quit; control groups receiving all other components of intervention; an outcome of smoking cessation rate at least six months after the start of the intervention. DATA COLLECTION AND ANALYSIS: Two assessors independently conducted data extraction on each paper, with disagreements resolved by consensus. Results were expressed as a relative risk (RR) for smoking cessation with 95% confidence intervals (CI). Where appropriate, a pooled effect was estimated using a Mantel-Haenszel fixed-effect method. MAIN RESULTS: We included 15 trials using a variety of biomedical tests. Two pairs of trials had sufficiently similar recruitment, setting and interventions to calculate a pooled effect; there was no evidence that carbon monoxide (CO) measurement in primary care (RR 1.06, 95% CI 0.85 to 1.32) or spirometry in primary care (RR 1.18, 95% CI 0.77 to 1.81) increased cessation rates. We did not pool the other 11 trials due to the presence of substantial clinical heterogeneity. Of the remaining 11 trials, two trials detected statistically significant benefits: one trial in primary care detected a significant benefit of lung age feedback after spirometry (RR 2.12, 95% CI 1.24 to 3.62) and one trial that used ultrasonography of carotid and femoral arteries and photographs of plaques detected a benefit (RR 2.77, 95% CI 1.04 to 7.41) but enrolled a population of light smokers and was judged to be at unclear risk of bias in two domains. Nine further trials did not detect significant effects. One of these tested CO feedback alone and CO combined with genetic susceptibility as two different interventions; none of the three possible comparisons detected significant effects. One trial used CO measurement, one used ultrasonography of carotid arteries and two tested for genetic markers. The four remaining trials used a combination of CO and spirometry feedback in different settings. AUTHORS' CONCLUSIONS: There is little evidence about the effects of most types of biomedical tests for risk assessment on smoking cessation. Of the fifteen included studies, only two detected a significant effect of the intervention. Spirometry combined with an interpretation of the results in terms of 'lung age' had a significant effect in a single good quality trial but the evidence is not optimal. A trial of carotid plaque screening using ultrasound also detected a significant effect, but a second larger study of a similar feedback mechanism did not detect evidence of an effect. Only two pairs of studies were similar enough in terms of recruitment, setting, and intervention to allow meta-analyses; neither of these found evidence of an effect. Mixed quality evidence does not support the hypothesis that other types of biomedical risk assessment increase smoking cessation in comparison to standard treatment. There is insufficient evidence with which to evaluate the hypothesis that multiple types of assessment are more effective than single forms of assessment.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Biomedical risk assessment as an aid for smoking cessation.

BACKGROUND: A possible strategy for increasing smoking cessation rates could be to provide smokers who have contact with healthcare systems with feedback on the biomedical or potential future effects of smoking, e.g. measurement of exhaled carbon monoxide (CO), lung function, or genetic susceptibility to lung cancer. We reviewed systematically data on smoking cessation rates from controlled trials that used biomedical risk assessment and feedback. OBJECTIVES: To determine the efficacy of biomedical risk assessment provided in addition to various levels of counselling, as a contributing aid to smoking cessation. SEARCH STRATEGY: We systematically searched he Cochrane Collaboration Tobacco Addiction Group Specialized Register, Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE (1966 to 2004), and EMBASE (1980 to 2004). We combined methodological terms with terms related to smoking cessation counselling and biomedical measurements. SELECTION CRITERIA: Inclusion criteria were: a randomized controlled trial design; subjects participating in smoking cessation interventions; interventions based on a biomedical test to increase motivation to quit; control groups receiving all other components of intervention; an outcome of smoking cessation rate at least six months after the start of the intervention. DATA COLLECTION AND ANALYSIS: Two assessors independently conducted data extraction on each paper, with disagreements resolved by consensus. MAIN RESULTS: From 4049 retrieved references, we selected 170 for full text assessment. We retained eight trials for data extraction and analysis. One of the eight used CO alone and CO + Genetic Susceptibility as two different intervention groups, giving rise to three possible comparisons. Three of the trials isolated the effect of exhaled CO on smoking cessation rates resulting in the following odds ratios (ORs) and 95% confidence intervals (95% CI): 0.73 (0.38 to 1.39), 0.93 (0.62 to 1.41), and 1.18 (0.84 to 1.64). Combining CO measurement with genetic susceptibility gave an OR of 0.58 (0.29 to 1.19). Exhaled CO measurement and spirometry were used together in three trials, resulting in the following ORs (95% CI): 0.6 (0.25 to 1.46), 2.45 (0.73 to 8.25), and 3.50 (0.88 to 13.92). Spirometry results alone were used in one other trial with an OR of 1.21 (0.60 to 2.42).Two trials used other motivational feedback measures, with an OR of 0.80 (0.39 to 1.65) for genetic susceptibility to lung cancer alone, and 3.15 (1.06 to 9.31) for ultrasonography of carotid and femoral arteries performed in light smokers (average 10 to 12 cigarettes a day). AUTHORS' CONCLUSIONS: Due to the scarcity of evidence of sufficient quality, we can make no definitive statements about the effectiveness of biomedical risk assessment as an aid for smoking cessation. Current evidence of lower quality does not however support the hypothesis that biomedical risk assessment increases smoking cessation in comparison with standard treatment. Only two studies were similar enough in term of recruitment, setting, and intervention to allow pooling of data and meta-analysis.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.