1000 resultados para test de memoria


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A través de un diseño intrasujeto contrabalanceado, y sobre una base de doble ciego, se han estudiado, en relación al placebo, 1os efectos de una dosis única de 20 mg. de clobazam sobre la memoria, atencion y tiempo de reaccion medidos a traves de pruebas de laboratorio. Se ha utilizado una muestra de 9 sujetos, universitarios voluntarios, sin patologia orgánica conocida y con puntuaciones medias en 10s factores neuroticismo y extroversión del E.P.I. No se han encontrado diferencias significativas entre el clobazam y el placebo, salvo en la prueba de Tolouse-Pieron, la cua1 pone de manifiesto un efecto detrimental del clobazam. Por otra parte, aunque no estadisticamente significativas, se han apreciado dos tendencias. En primer lugar, el clobazam tiende a disminuir el rendimiento mnemico y de atencion y a incrementar la rapidez de respuesta en comparación con el placebo; en segundo lugar, el clobazam inhibe el efecto de practica en las aplicaciones sucesivas de las pruebas de atención y memoria y 10 potencia en el caso del tiempo de reaccion. Por todo ello se requiere una investigacion adicional con mas sujetos y un diseño experimental más complejo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

El Ateneu Flor de Maig fue construido en Poblenou (Barcelona) hace más de cien años como sede de una de las mayores cooperativas de Catalunya. Desde su fundación hasta hoy día siempre ha estado ligado a la memoria del barrio, representando un símbolo de resistencia y cooperación para muchos de los vecinos del Poblenou. El pasado 2012 en el contexto de recortes que llevan a cabo las distintas administraciones públicas del Estado, el dinero municipal que proveía del pago del alquiler a los dueños del edificio y que ponía a disposición de los vecinos su uso, deja de llegar y éstos cierran sus puertas y con ello el espacio de articulación vecinal que suponía. Meses después, diversos colectivos del barrio agrupados bajo la Plataforma Recuperem La Flor de Maig, deciden “okupar” el edificio y convertirlo, según sus discursos, en un elemento de “transformación”, una alternativa frente al contexto de intervención y reforma urbana que representa el 22@ donde se dan la mano formas de gestión asamblearias, usos alternativos del espacio y una reivindicación del espíritu cooperativo inicial, dando así continuidad a toda una tradición de resistencia común. Sin embargo, los colectivos que okupan el Ateneu mantienen intereses y formas de entender su uso enfrentadas, lo que provoca conflictos y roces, no solo entre ellos sino también con otros vecinos del entorno, originando determinadas respuestas. Activistas, jóvenes de la izquierda independentista, desempleados, cooperativistas, emprendedores y artistas se mezclan en la Assemblea y Comisiones de la Flor de Maig. Desde la antropología nos podemos acercar a esa situación bajo la consideración de “frontera” en el uso del espacio. Este experimento “transformador” podría llegar a suponer, por otro lado, un “caballo de Troya” involuntario que ahonde en el proceso de desplazamiento de la población original del barrio iniciado hace unos años, favoreciendo su terciariación y aburguesamiento.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).