Miscibility studies in poly(methyl vinyl ether)/hydroxypropylcellulose binary system in aqueous solutions and solid state

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Survival of Lactobacillus plantarum in model solutions and fruit juices

The aim of the work was to study the survival of Lactobacillus plantarum NCIMB 8826 in model solutions and develop a mathematical model describing its dependence on pH, citric acid and ascorbic acid. A Central Composite Design (CCD) was developed studying each of the three factors at five levels within the following ranges, i.e., pH (3.0-4.2), citric acid (6-40 g/L), and ascorbic acid (100-1000 mg/L). In total, 17 experimental runs were carried out. The initial cell concentration in the model solutions was approximately 1 × 10(8)CFU/mL; the solutions were stored at 4°C for 6 weeks. Analysis of variance (ANOVA) of the stepwise regression demonstrated that a second order polynomial model fits well the data. The results demonstrated that high pH and citric acid concentration enhanced cell survival; one the other hand, ascorbic acid did not have an effect. Cell survival during storage was also investigated in various types of juices, including orange, grapefruit, blackcurrant, pineapple, pomegranate, cranberry and lemon juice. The model predicted well the cell survival in orange, blackcurrant and pineapple, however it failed to predict cell survival in grapefruit and pomegranate, indicating the influence of additional factors, besides pH and citric acid, on cell survival. Very good cell survival (less than 0.4 log decrease) was observed after 6 weeks of storage in orange, blackcurrant and pineapple juice, all of which had a pH of about 3.8. Cell survival in cranberry and pomegranate decreased very quickly, whereas in the case of lemon juice, the cell concentration decreased approximately 1.1 logs after 6 weeks of storage, albeit the fact that lemon juice had the lowest pH (pH~2.5) among all the juices tested. Taking into account the results from the compositional analysis of the juices and the model, it was deduced that in certain juices, other compounds seemed to protect the cells during storage; these were likely to be proteins and dietary fibre In contrast, in certain juices, such as pomegranate, cell survival was much lower than expected; this could be due to the presence of antimicrobial compounds, such as phenolic compounds.

Investigation of the factors influencing the survival of Bifidobacterium longum in model acidic solutions and fruit juices

The survival of Bifidobacterium longum NCIMB 8809 was studied during refrigerated storage for 6 weeks in model solutions, based on which a mathematical model was constructed describing cell survival as a function of pH, citric acid, protein and dietary fibre. A Central Composite Design (CCD) was developed studying the influence of four factors at three levels, i.e., pH (3.2–4), citric acid (2–15 g/l), protein (0–10 g/l), and dietary fibre (0–8 g/l). In total, 31 experimental runs were carried out. Analysis of variance (ANOVA) of the regression model demonstrated that the model fitted well the data. From the regression coefficients it was deduced that all four factors had a statistically significant (P < 0.05) negative effect on the log decrease [log10N0 week−log10N6 week], with the pH and citric acid being the most influential ones. Cell survival during storage was also investigated in various types of juices, including orange, grapefruit, blackcurrant, pineapple, pomegranate and strawberry. The highest cell survival (less than 0.4 log decrease) after 6 weeks of storage was observed in orange and pineapple, both of which had a pH of about 3.8. Although the pH of grapefruit and blackcurrant was similar (pH ∼3.2), the log decrease of the former was ∼0.5 log, whereas of the latter was ∼0.7 log. One reason for this could be the fact that grapefruit contained a high amount of citric acid (15.3 g/l). The log decrease in pomegranate and strawberry juices was extremely high (∼8 logs). The mathematical model was able to predict adequately the cell survival in orange, grapefruit, blackcurrant, and pineapple juices. However, the model failed to predict the cell survival in pomegranate and strawberry, most likely due to the very high levels of phenolic compounds in these two juices.

Hydrogen-bonding-driven self-assembly of PEGylated organosilica nanoparticles with poly(acrylic acid) in aqueous solutions and in layer-by-layer deposition at solid surfaces

PEGylated organosilica nanoparticles have been synthesized through self-condensation of (3-mercaptopropyl)trimethoxysilane in dimethyl sulfoxide into thiolated nanoparticles with their subsequent reaction with methoxypoly(ethylene glycol) maleimide. The PEGylated nanoparticles showed excellent colloidal stability over a wide range of pH in contrast to the parent thiolated nanoparticles, which have a tendency to aggregate irreversibly under acidic conditions (pH < 3.0). Due to the presence of a poly(ethylene glycol)-based corona, the PEGylated nanoparticles are capable of forming hydrogen-bonded interpolymer complexes with poly(acrylic acid) in aqueous solutions under acidic conditions, resulting in larger aggregates. The use of hydrogen-bonding interactions allows more efficient attachment of the nanoparticles to surfaces. The alternating deposition of PEGylated nanoparticles and poly(acrylic acid) on silicon wafer surfaces in a layer-by-layer fashion leads to multilayered coatings. The self-assembly of PEGylated nanoparticles with poly(acrylic acid) in aqueous solutions and at solid surfaces was compared to the behavior of linear poly(ethylene glycol). The nanoparticle system creates thicker layers than the poly(ethylene glycol), and a thicker layer is obtained on a poly(acrylic acid) surface than on a silica surface, because of the effects of hydrogen bonding. Some implications of these hydrogen-bonding-driven interactions between PEGylated nanoparticles and poly(acrylic acid) for pharmaceutical formulations are discussed.

Effect of water-soluble polymers, polyethylene glycol and poly(vinylpyrrolidone),on the gelation of aqueous micellar solutions of Pluronic copolymer F127

The micellization of F127 (E98P67E98) in dilute aqueous solutions of polyethylene glycol (PEG6000 and PEG35000) and poly(vinylpyrrolidone) (PVP K30 and PVP K90) is studied. The average hydrodynamic radius (rh,app) obtained from the dynamic light scattering technique increased with increase in PEG concentration but decreased on addition of PVP, results which are consistent with interaction of the micelles with PEG and the formation of micelles clusters, but no such interaction occurs with PVP. Tube inversion was used to determine the onset of gelation. The critical concentration of F127 for gelation increased on addition of PEG and of PVP K30 but decreased on addition of PVP K90. Small-angle X-ray scattering (SAXS) was used to show that the 30 wt% F127 gel structure (fcc) was independent of polymer type and concentration, as was the d-spacing and so the micelle hard-sphere radius. The maximum elastic modulus (G0 max) of 30 wt% F127 decreased from its value for water alone as PEG was added, but was little changed by adding PVP. These results are consistent with the packed-micelles in the 30 wt% F127 gel being effectively isolated from the polymer solution on the microscale while, especially for the PEG, being mixed on the macroscale.

A novel X-ray rheometer for in situ studies of polymer melts and solutions during shear flow

A novel X-ray rheometer based on a parallel plate geometry is described. This system allows time-resolved X-ray scattering intensity data to be obtained from polymeric samples subjected to shear flow. The range of quantitative structural parameters, such as molecular orientation and inter chain correlations, which can be obtained from the data is highlighted. Examples of the utility of X-ray scattering in examining optically opaque samples and the extraction of 〈P2〉 and 〈P4〉 orientation parameters are given using anisotropic hydroxypropylcellulose solutions as the sample.

Grid computing solutions for distributed repositories of protein folding and unfolding simulations

The P-found protein folding and unfolding simulation repository is designed to allow scientists to perform analyses across large, distributed simulation data sets. There are two storage components in P-found: a primary repository of simulation data and a data warehouse. Here we demonstrate how grid technologies can support multiple, distributed P-found installations. In particular we look at two aspects, first how grid data management technologies can be used to access the distributed data warehouses; and secondly, how the grid can be used to transfer analysis programs to the primary repositories --- this is an important and challenging aspect of P-found because the data volumes involved are too large to be centralised. The grid technologies we are developing with the P-found system will allow new large data sets of protein folding simulations to be accessed and analysed in novel ways, with significant potential for enabling new scientific discoveries.

Complex formation in solutions of oppositely charged polyelectrolytes at different polyion compositions and salt content

The formation of complexes in solutions containing positively charged polyions (polycations) and a variable amount of negatively charged polyions (polyanions) has been investigated by Monte Carlo simulations. The polyions were described as flexible chains of charged hard spheres interacting through a screened Coulomb potential. The systems were analyzed in terms of cluster compositions, structure factors, and radial distribution functions. At 50% charge equivalence or less, complexes involving two polycations and one polyanion were frequent, while closer to charge equivalence, larger clusters were formed. Small and neutral complexes dominated the solution at charge equivalence in a monodisperse system, while larger clusters again dominated the solution when the polyions were made polydisperse. The cluster composition and solution structure were also examined as functions of added salt by varying the electrostatic screening length. The observed formation of clusters could be rationalized by a few simple rules.