980 resultados para sponge, luciferase, cloning, Suberites
Resumo:
Three dermaseptins, DS 01, DD K, and DD L, were compared with respect to their structural features and interactions with liposomes. Circular dichroic spectra at alcohols of different chain lengths revealed that DS 01 has the higher helicogenic potential in hydrophobic media. Binding of DS 01, DD K, and DD L to liposomes induced significant blue shifts of the emission spectra of the single tryptophan located at position 3 of all sequences indicating association of the peptides with bilayers. Kinetics evaluation of atomic force microscopy images evidenced the strong fusogenic activity of DS 01 whereas DD K and DD L showed increased lytic activities. (C) 2007 Elsevier Inc. All rights reserved.
Resumo:
Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.
Resumo:
The secreted phospholipases A(2) (sPLA(2)s) are water-soluble enzymes that bind to the surface of both artificial and biological lipid bilayers and hydrolyze the membrane phospholipids. The tissue expression pattern of the human group IID secretory phospholipase A(2) (hsPLA(2)-IID) suggests that the enzyme is involved in the regulation of the immune and inflammatory responses. With an aim to establish an expression system for the hsPLA(2)-IID in Escherichia coli, the DNA-coding sequence for hsPLA(2)-IID was subcloned into the vector pET3a, and expressed as inclusion bodies in E. coli (BL21). A protocol has been developed to refold the recombinant protein in the presence of guanidinium hydrochloride, using a size-exclusion chromatography matrix followed by dilution and dialysis to remove the excess denaturant. After purification by cation-exchange chromatography, far ultraviolet circular dichroism spectra of the recombinant hsPLA(2)-IID indicated protein secondary structure content similar to the homologous human group IIA secretory phospholipase A(2). The refolded recombinant hsPLA(2)-IID demonstrated Ca(2+)-dependent hydrolytic activity, as measuring the release free fatty acid from phospholipid liposomes. This protein expression and purification system may be useful for site-directed mutagenesis experiments of the hsPLA(2)-IID which will advance our understanding of the structure-function relationship and biological effects of the protein. (C) 2009 Elsevier Inc. All rights reserved.
Resumo:
Sulfate is required for detoxification of xenobiotics such as acetaminophen (APAP), a leading cause of liver failure in humans. The NaS1 sulfate transporter maintains blood sulfate levels sufficiently high for sulforiation reactions to work effectively for drug detoxification. In the present study, we identified two loss-of-function polymorphisms in the human NaS1 gene and showed the Nas1-null mouse to be hypersensitive to APAP hepatotoxicity. APAP treatment led to increased liver damage and decreased hepatic glutathione levels in the hyposulfatemic Nas1-null mice compared with that in normosulfatemic wild-type mice. Analysis of urinary APAP metabolites revealed a significantly lower ratio of APAP-sulfate to APAP-glucuronide in the Nas1-null mice. These results suggest hyposulfatemia increases sensitivity to APAP-induced hepatotoxicity by decreasing the sulfonation capacity to metabolize APAP. In conclusion, the results of this study highlight the importance of plasma sulfate level as a key modulator of acetaminophen metabolism and suggest that individuals with reduced NaS1 sulfate transporter function would be more sensitive to hepatotoxic agents.
Resumo:
Aldehyde dehydrogenases (ALDHs) catabolize toxic aldehydes and process the vitamin A-derived retinaldehyde into retinoic acid (RA), a small diffusible molecule and a pivotal chordate morphogen. In this study, we combine phylogenetic, structural, genomic, and developmental gene expression analyses to examine the evolutionary origins of ALDH substrate preference. Structural modeling reveals that processing of small aldehydes, such as acetaldehyde, by ALDH2, versus large aldehydes, including retinaldehyde, by ALDH1A is associated with small versus large substrate entry channels (SECs), respectively. Moreover, we show that metazoan ALDH1s and ALDH2s are members of a single ALDH1/2 clade and that during evolution, eukaryote ALDH1/2s often switched between large and small SECs after gene duplication, transforming constricted channels into wide opened ones and vice versa. Ancestral sequence reconstructions suggest that during the evolutionary emergence of RA signaling, the ancestral, narrow-channeled metazoan ALDH1/2 gave rise to large ALDH1 channels capable of accommodating bulky aldehydes, such as retinaldehyde, supporting the view that retinoid-dependent signaling arose from ancestral cellular detoxification mechanisms. Our analyses also indicate that, on a more restricted evolutionary scale, ALDH1 duplicates from invertebrate chordates (amphioxus and ascidian tunicates) underwent switches to smaller and narrower SECs. When combined with alterations in gene expression, these switches led to neofunctionalization from ALDH1-like roles in embryonic patterning to systemic, ALDH2-like roles, suggesting functional shifts from signaling to detoxification.
Resumo:
We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Context: Necdin activates GNRH gene expression and is fundamental for the development, migration, and axonal extension of murine GNRH neurons. In humans, necdin plays a potential role in the hypogonadotropic hypogonadism phenotype in patients with Prader-Willi syndrome. Aim: To investigate necdin gene (NDN) variants in patients with isolated hypogonadotropic hypogonadism (IHH). Patients and methods: We studied 160 Brazilian patients with IHH, which includes 92 with Kallmann syndrome and 68 with normosmic IHH. Genomic DNA was extracted and the single NDN exon was amplified and sequenced. To measure GNRH transcriptional activity, luciferase reporter plasmids containing GNRH regulatory regions were transiently transfected into GT1-7 cells in the presence and absence of overexpressed wild-type or mutant necdin. Results: A heterozygous variant of necdin, p.V318A, was identified in a 23-year-old male with Kallmann syndrome. The p.V318A was also present in affected aunt and his father and was absent in 100 Brazilian control subjects. Previous FGFR1 gene analysis revealed a missense mutation (p.P366L) in this family. Functional studies revealed a minor difference in the activation of GNRH transcription by mutant protein compared with wild type in that a significant impairment of the necdin protein activity threshold was observed. Conclusion: A rare variant of necdin (p.V318A) was described in a family with Kallmann syndrome associated with a FGFR1 mutation. Familial segregation and in vitro analysis suggested that this non-synonymous variant did not have a direct causative role in the hypogonadism phenotype. NDN mutations are not a frequent cause of congenital IHH.
Resumo:
The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. The GlyR comprises a pentameric complex that forms a chloride-selective transmembrane channel, which is predominantly expressed in the spinal cord and brain stem. We review the pharmacological and physiological properties of the GlyR and relate this information to more recent insights that have been obtained through the cloning and recombinant expression of the GlyR subunits. We also discuss insights into our understanding of GlyR structure and function that have been obtained by the genetic characterisation of various heritable disorders of glycinergic neurotransmission. (C) 1997 Elsevier Science Inc.
Resumo:
We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmsery1 is discussed in relation to possible functions during development.
Resumo:
All Tn5 insertion mutants of Xanthomonas albilineans, the cause of leaf scald disease of sugar cane, which failed to produce albicidin antibiotics failed to cause chlorosis in inoculated sugar cane but- remained resistant to albicidin. Southern analysis revealed that mutants deficient in albicidin production carried the transposon on different chromosomal restriction fragments spanning at least: 50 kb in the X. albilineans genome, which is larger than any reported cluster of genes involved in the production of a bacterial phytotoxin. Albicidin-resistant cosmid clones from a Tox(-) Tn5 insertion mutant did not carry the transposon, and the subcloned albicidin resistance gene did not hybridize to any of the restriction fragments carrying Tn5 in the Tox(-) mutants, indicating that the albicidin biosynthesis and resistance genes are not closely linked in X. albilineans.
Resumo:
Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.
Resumo:
The results of this study challenge the widely held view that growth hormone (GH) acts only during the postnatal period. RNA phenotyping shows transcripts for the GH receptor and GH-binding protein in mouse preimplantation embryos of all stages from fertilized eggs (day 1) to blastocysts (day 4). An antibody specific to the cytoplasmic region of the GH receptor revealed receptor protein expression, first in two-cell embryos, the stage of activation of the embryonic genome (day 2), and in all subsequent stages, In cleavage-stage embryos this immunoreactivity was localized mainly to the nucleus, but clear evidence of membrane labeling was apparent in blastocysts. GH receptor immunoreactivity was also observed in cumulus cells associated with unfertilized oocytes but not in the unfertilized oocytes. The blastocyst receptor was demonstrated to be functional, exhibiting the classic bell-shaped dose-response curves for GH stimulation of both 3-O-methyl glucose transport and protein synthesis. Maximal stimulation of 40-50% was seen for both responses at less than 1 ng/ml recombinant GH, suggesting a role for maternal GK. However mRNA transcripts for GH were also detected from the morula stage (day 3) by using reverse transcription-PCR, and GH immunoreactivity was seen in blastocysts. These observations raise the possibility of a paracrine/autocrine GH loop regulating embryonic development in its earliest stages.
Resumo:
Cytokines are secreted proteins that regulate important cellular responses such as proliferation and differentiation(1). Key events in cytokine signal transduction are well defined: cytokines induce receptor aggregation, leading to activation of members of the JAK family of cytoplasmic tyrosine kinases. In turn, members af the STAT family of transcription factors are phosphorylated, dimerize and increase the transcription of genes with STAT recognition sites in their promoters(1-4). Less is known of how cytokine signal transduction is switched off. We have cloned a complementary DNA encoding a protein SOCS-1, containing an SH2-domain, by its ability to inhibit the macrophage differentiation of M1 cells in response to interleukin-6. Expression of SOCS-1 inhibited both interleukin-6-induced receptor phosphorylation and STAT activation. We have also cloned two-relatives of SOCS-1, named SOCS-2 and SOCS-3, which together with the previously described CIS (ref. 5) form a new family of proteins. Transcription of all four SOCS genes is increased rapidly in response to interleukin-6, in vitro and in vivo, suggesting they may act in a classic negative feedback loop to regulate cytokine signal transduction.
Resumo:
Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.