945 resultados para cDNA-RDA
Resumo:
Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.
Resumo:
Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.
Resumo:
The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P<0.0001). Moreover,FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs=0.317, P=0.006), hemoglobin levels (rs=0.210, P=0.049), and percentage of peripheral blood blasts (rs=0.256, P=0.027), but inversely correlated with hemoglobin levels in the control group (rs=–0.391, P<0.0001). AML patients with high CD34+ expression showed significantly higherFAMLF-CS expression than those with low CD34+ expression (P=0.041). Our results showed thatFAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.
Resumo:
Dentro do contexto de assegurar à população dietas equilibradas em relação aos elementos essenciais e uma monitoração dos elementos tóxicos, este trabalho teve por objetivo a determinação dos níveis desses elementos, em refeições servidas no restaurante da Faculdade de Saúde Pública/USP freqüentada pelos estudantes universitários e funcionários, durante uma semana. Foram analisadas refeições servidas no almoço. Os alimentos foram recolhidos em bandejas completas em número de 3 por refeição, tomando-se por base as porções servidas, consideradas como análise em duplicata. Foram feitas análises para determinação da composição centesimal das refeições utilizando-se os métodos preconizados pela AOAC. As amostras foram submetidas também a análise multielementar utilizando-se a técnica de análise por ativação neutrônica, onde os seguintes elementos puderam ser determinados: Ba, Br, Ca, Ce, Cl, Co, Cr, Cs, Fe, K, Mg, Mn, Mo, Na, Rb, Sb, Sc, Se e Zn, níveis de m g/g a ng/g. Os resultados de ingestão por refeição obtidos no presente trabalho foram comparados com os valores diários recomendados pelo RDA, WHO e Homem Padrão. Salienta-se em relação aos macronutrientes, uma alta adequação protéica e excesso de lípides em algumas refeições, interferindo no valor calórico total. Dentre as causas de maior variação dos resultados a dieta entre os diferentes dias é a que mais contribui. Em relação à fração fibra alimentar, os valores obtidos foram adequados. Quanto aos micronutrientes, observa-se adequação quanto a Br, Ca, Fe, Mg, Mn, Rb, Se e Zn, entretanto, níveis acima do recomendado para K, Mo, Na, Cl e Cr. Para os elementos Ba, Co, Cs e Sb os níveis de ingestão foram comparados com os dados de ingestão diária para Homem Padrão. Os demais elementos traço determinados como Ce e Sc, observa-se que não existe recomendação, tendo-se observado grandes variações nos valores obtidos para estes elementos nos dias estudados.
Resumo:
O presente trabalho teve por objetivo caracterizar quimicamente os mingaus desidratados de arroz e soja nas respectivas proporções 100:0, 90:10, 80:20, 70:30, 60:40 e 50:50% e verificar a possibilidade do uso de alguns destes mingaus como ingredientes na formulação de alimentos infantis com base nos resultados discutidos. O processo utilizado para sua obtenção foi decorticagem dos grãos de soja, branqueamento, desintegração e homogeneização do arroz e soja, assim como secagem por atomização. A caracterização química foi realizada através das seguintes determinações: composição centesimal, composição de minerais e de aminoácidos, e atividade do inibidor de tripsina. Com o aumento das proporções de soja (de 0 a 50%), os mingaus desidratados tiveram aumento nos teores de proteína, extrato etéreo, cinzas, fibra bruta, fósforo, cálcio, potássio, magnésio, ferro, cobre, zinco, selênio, manganês e molibdênio, porém diminuição nos teores de carboidrato, sódio e cromo. Contudo, os valores de cobalto não foram alterados. Os teores de potássio, magnésio, ferro e cobre foram altos e os teores de cromo, selênio, manganês e molibdênio foram suficientes em 100g de mingaus desidratados de arroz e soja com 40 e 50% de soja, atendendo 100% das recomendações da RDA para lactentes, podendo estes formulados para alimentos infantis. Houve uma melhoria nos escores de aminoácidos essenciais com as crescentes proporções de soja, exceto para os aminoácidos sulfurados. A composição em aminoácidos foi adequada e comparável ao padrão da FAO/WHO para lactentes, exceto para lisina e metionina. Em relação a lisina, os mingaus desidratados com 30, 40 e 50% de soja mostraram os maiores escores para pré-escolares, não havendo deficiência para escolares. Por outro lado, a metionina não foi deficiente para pré-escolares e escolares. A atividade residual do inibidor de tripsina não foi observada nos mingaus desidratados estudados.
Resumo:
O uso de vegetais tem-se difundido largamente nos últimos anos para fins alimentícios, medicinais e cosméticos. Devido à importância do estudo da composição inorgânica desses vegetais, o presente trabalho se propõe a analisar a ocorrência de minerais com comprovadas funções no metabolismo humano em dez ervas de popular uso terapêutico. As amostras estudadas foram tratadas por dois métodos distintos: calcinação seguida de tratamento ácido ou infusão para a obtenção dos chás. Posteriormente, os metais foram determinados quantitativamente utilizando-se espectrofotometria de absorção atômica (Ca, Mg, Mn e Zn), espectrofotometria de absorção molecular (Al e Fe) e fotometria de chama (K e Na). Comparando-se os resultados encontrados no presente trabalho com os valores diários recomendados pela RDA e WHO, sugere-se estudos para a utilização de Chenopodium ambrosioides L. como uma fonte alternativa complementar de Na, K, Mg e Zn, e do Ageratum conyzoides L. como fonte de Ca, Mg e Fe na dieta alimentar. Embora Lippia alba e Justicia gendarussa L. tenham apresentado elevados valores de Ca, recomenda-se uma certa prudência quanto ao uso desse vegetal, devido aos significativos teores encontrados para Al.
Resumo:
A partir de extrato solúvel de soja e extrato solúvel de soja desengordurado, foram desenvolvidos dois formulados em pó, os quais foram denominados: FPSA-formulado com extrato solúvel de soja (PSA) e FPS60-formulado com extrato solúvel de soja desengordurado (PS60). Além do PSA e PS60, outros produtos foram utilizados na elaboração dos formulados: clara de ovo desidratada, maltodextrina, óleo de soja, óleo de canola, gordura-de-coco, "mix" de vitaminas e minerais e estabilizante. Zinco, selênio e magnésio foram adicionados para atender a 200% das recomendações diárias sugeridas pela RDA. A avaliação da qualidade protéica foi conduzida por meio de ensaio biológico com animais experimentais, no qual foram analisados NPR, NPU e digestibilidade. Não houve diferença significativa entre o FPSA e FPS60, quanto ao NPR e NPU (p > 0,05), e o mesmo ocorreu em comparação com a caseína. Quanto à digestibilidade, os formulados apresentaram resultados semelhantes, porém inferiores aos da caseína. Os formulados mostraram bom valor biológico, pois apresentaram índices de qualidade protéica próximos aos da caseína.
Resumo:
Informações sobre a composição de alimentos nacionais são escassas. Sucos concentrados de frutas são amplamente utilizados por famílias brasileiras. No presente trabalho foram determinados oito elementos minerais (K, Na, Ca, Mg, Fe, Zn, Cu, Mn) com importância nutricional em sucos concentrados comerciais de frutas nacionais, abacaxi (3 marcas), acerola (2 marcas), caju (5 marcas), goiaba (3 marcas), manga (2 marcas), maracujá (5 marcas) e pitanga (1 marca) por espectrometria de absorção atômica com atomização em chama. A contribuição nutricional dos sucos para a dieta de crianças após a diluição recomendada pelo fabricante e considerando a ingestão diária de um copo de 300mL é elevada quanto a potássio para todos os sucos examinados (170 - 930% da ingestão diária recomendada, RDA). Os sucos de abacaxi e acerola podem fornecer 6 e 12% da RDA de ferro, respectivamente. O manganês aparece em abacaxi, manga, goiaba e acerola com 38, 14, 8 e 7% do RDA, respectivamente. Magnésio varia entre um máximo de 9% do RDA em abacaxi e 2% em maracujá e caju. Zinco e cobre variaram entre menos de 1 - 2% do RDA em sucos de caju e pitanga, a 2 - 6% nos outros sucos. Para adultos as contribuições são proporcionalmente menores, porém em nada desprezíveis.
Resumo:
Sweet potato is an important staple, and it is mainly known for its contribution of β-carotene in human diet. The effects of cultivar and habitat on this pigment and other nutritional characteristics of the crop still require investigation. In this study, three locally bred cultivars of sweet potato, two of which are orange-fleshed, were grown in three different agro-ecological areas to determine soluble sugar content, β-carotene, and total antioxidants of roots. In addition antioxidant activity, total carotenoids, and chlorophyll content were determined in edible leaves. Reducing sugars, β-carotene, total antioxidants capacity, total carotenoids, and chlorophyll content were significantly affected by environmental conditions. The location at lower altitude and closer to the coastline showed high evapotranspiration, thus reducing sugar content, antioxidant activity, and phytonutrients in both storage roots and leaves. Absence of water stress in agro-ecological locations further inland and at higher altitudes was associated with an increase in these compounds. Free radical scavenging activity of DPPH was higher in the storage roots (610.49 µmoles TE/100g) than in the leaves (426.06 µmoles TE/100g); nevertheless, opposite results were found for the ferric ion reducing activity (FRAP). The deep orange-fleshed cultivar A45 contained high β-carotene (15 mg/100g), which is enough to meet RDA for vitamin A. There is evidence of agro-ecological effect on sweet potato nutritional value.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Marja-Liisa Seppälän esitys Sisällönkuvailupäivässä Helsingissä 18.11.2015.
Resumo:
Artikel i festskrift.
Resumo:
The objective of this study was to partially characterize some genes involved in the desiccation tolerance of the embryonic axis of Melanoxylon brauna seeds subjected, or not, to oven fast-drying. Seeds were initially dried rapidly in an oven at 40 ºC, 50 ºC, 60 ºC, 70 ºC, and 80 °C, for 24, 48 and 72 h and then subjected to germination tests and moisture content determination. Degenerate primers were designed for 19 genes. The CDNA was used as a template for PCR amplifications using the degenerate primers, and the PCR products obtained were purified, cloned and sequenced. The seeds showed a gradual reduction in percent germination with increasing temperature and drying time. Nucleotide sequences of the cloned fragments related to genes CAT1, SPS1, Abi5, Transk and PM25 were obtained. The similarity analysis with the sequences deposited in databases revealed similarities with genes CAT1, SPS1, Transk and PM25 from other plant species. The nucleotide sequences obtained from the respective genes will be used for designing specific primers for gene expression analyses during seed germination in order to understand the causes for loss of physiological quality of Melanoxylon brauna seeds.
Resumo:
The adapted metabolic response of commercial wine yeast under prolonged exposure to concentrated solutes present in Icewine juice is not fully understood. Presently, there is no information regarding the transcriptomic changes in gene expression associated with the adaptive stress response ofwine yeast during Icewine fermentation compared to table wine fermentation. To understand how and why wine yeast respond differently at the genomic level and ultimately at the metabolic level during Icewine fermentation, the focus ofthis project was to identify and compare these differences in the wine yeast Saccharomyces cerevisiae KI-Vll16 using cDNA microarray technology during the first five days of fermentation. Significant differences in yeast gene expression patterns between fermentation conditions were correlated to differences in nutrient utilization and metabolite production. Sugar consumption, nitrogen usage and metabolite levels were measured using enzyme assays and HPLC. Also, a small subset of differentially expressed genes was verified using Northern analysis. The high osmotic stress experienced by wine yeast throughout Icewine fermentation elicited changes in cell growth and metabolism correlating to several fermentation difficulties, including reduced biomass accumulation and fermentation rate. Genes associated with carbohydrate and nitrogen transport and metabolism were expressed at lower levels in Icewine juice fermenting cells compared to dilute juice fermenting cells. Osmotic stress, not nutrient availability during Icewine fermentation appears to impede sugar and nitrogen utilization. Previous studies have established that glycerol and acetic acid production are increased in yeast during Icewine fermentation. A gene encoding for a glycerollW symporter (STL1) was found to be highly expressed up to 25-fold in the i Icewine juice condition using microarray and Northern analysis. Active glycerol transport by yeast under hyperosmotic conditions to increase cytosolic glycerol concentration may contribute to reduced cell growth observed in the Icewine juice condition. Additionally, genes encoding for two acetyl CoA synthetase isoforms (ACSl and ACS2) were found to be highly expressed, 19- and II-fold respectively, in dilute juice fermenting cells relative to the Icewine juice condition. Therefore, decreased conversion of acetate to acetyl-CoA may contribute to increased acetic acid production during Icewine fermentation. These results further help to explain the response of wine yeast as they adapt to Icewine juice fermentation. ii
Resumo:
The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.