Cloning, purification and comparative characterization of two digestive lysozymes from Musca domestica larvae

cDNA coding for two digestive lysozymes (MdL1 and MdL2) of the Musca domestica housefly was cloned and sequenced. MdL2 is a novel minor lysozyme, whereas MdL1 is the major lysozyme thus far purified from M. domestica midgut. MdL1 and MdL2 were expressed as recombinant proteins in Pichia pastoris, purified and characterized. The lytic activities of MdL1 and MdL2 upon Micrococcus lysodeikticus have an acidic pH optimum (4.8) at low ionic strength (μ = 0.02), which shifts towards an even more acidic value, pH 3.8, at a high ionic strength (μ = 0.2). However, the pH optimum of their activities upon 4-methylumbelliferyl N-acetylchitotrioside (4.9) is not affected by ionic strength. These results suggest that the acidic pH optimum is an intrinsic property of MdL1 and MdL2, whereas pH optimum shifts are an effect of the ionic strength on the negatively charged bacterial wall. MdL2 affinity for bacterial cell wall is lower than that of MdL1. Differences in isoelectric point (pI) indicate that MdL2 (pI = 6.7) is less positively charged than MdL1 (pI = 7.7) at their pH optima, which suggests that electrostatic interactions might be involved in substrate binding. In agreement with that finding, MdL1 and MdL2 affinities for bacterial cell wall decrease as ionic strength increases.

Participation of the endoplasmic reticulum protein chaperone thio-oxidoreductase in gonadotropin-releasing hormone receptor expression at the plasma membrane

Chaperone members of the protein disulfide isomerase family can catalyze the thiol-disulfide exchange reaction with pairs of cysteines. There are 14 protein disulfide isomerase family members, but the ability to catalyze a thiol disulfide exchange reaction has not been demonstrated for all of them. Human endoplasmic reticulum protein chaperone thio-oxidoreductase (ERp18) shows partial oxidative activity as a protein disulfide isomerase. The aim of the present study was to evaluate the participation of ERp18 in gonadotropin-releasing hormone receptor (GnRHR) expression at the plasma membrane. Cos-7 cells were cultured, plated, and transfected with 25 ng (unless indicated) wild-type human GnRHR (hGnRHR) or mutant GnRHR (Cys14Ala and Cys200Ala) and pcDNA3.1 without insert (empty vector) or ERp18 cDNA (75 ng/well), pre-loaded for 18 h with 1 µCi myo-[2-3H(N)]-inositol in 0.25 mL DMEM and treated for 2 h with buserelin. We observed a decrease in maximal inositol phosphate (IP) production in response to buserelin in the cells co-transfected with hGnRHR, and a decrease from 20 to 75 ng of ERp18 compared with cells co-transfected with hGnRHR and empty vector. The decrease in maximal IP was proportional to the amount of ERp18 DNA over the range examined. Mutants (Cys14Ala and Cys200Ala) that could not form the Cys14-Cys200 bridge essential for plasma membrane routing of the hGnRHR did not modify maximal IP production when they were co-transfected with ERp18. These results suggest that ERp18 has a reduction role on disulfide bonds in wild-type hGnRHR folding.

Gene trio signatures as molecular markers to predict response to doxorubicin cyclophosphamide neoadjuvant chemotherapy in breast cancerpatients

In breast cancer patients submitted to neoadjuvant chemotherapy (4 cycles of doxorubicin and cyclophosphamide, AC), expression of groups of three genes (gene trio signatures) could distinguish responsive from non-responsive tumors, as demonstrated by cDNA microarray profiling in a previous study by our group. In the current study, we determined if the expression of the same genes would retain the predictive strength, when analyzed by a more accessible technique (real-time RT-PCR). We evaluated 28 samples already analyzed by cDNA microarray, as a technical validation procedure, and 14 tumors, as an independent biological validation set. All patients received neoadjuvant chemotherapy (4 AC). Among five trio combinations previously identified, defined by nine genes individually investigated (BZRP, CLPTM1,MTSS1, NOTCH1, NUP210, PRSS11, RPL37A, SMYD2, and XLHSRF-1), the most accurate were established by RPL37A, XLHSRF-1based trios, with NOTCH1 or NUP210. Both trios correctly separated 86% of tumors (87% sensitivity and 80% specificity for predicting response), according to their response to chemotherapy (82% in a leave-one-out cross-validation method). Using the pre-established features obtained by linear discriminant analysis, 71% samples from the biological validation set were also correctly classified by both trios (72% sensitivity; 66% specificity). Furthermore, we explored other gene combinations to achieve a higher accuracy in the technical validation group (as a training set). A new trio, MTSS1, RPL37 and SMYD2, correctly classified 93% of samples from the technical validation group (95% sensitivity and 80% specificity; 86% accuracy by the cross-validation method) and 79% from the biological validation group (72% sensitivity and 100% specificity). Therefore, the combined expression of MTSS1, RPL37 and SMYD2, as evaluated by real-time RT-PCR, is a potential candidate to predict response to neoadjuvant doxorubicin and cyclophosphamide in breast cancer patients.

Transcriptional regulation of bidirectional gene pairs by 17-β-estradiol in MCF-7 breast cancer cells

Using cDNA microarray analysis, we previously identified a set of differentially expressed genes in primary breast tumors based on the status of estrogen and progesterone receptors. In the present study, we performed an integrated computer-assisted and manual search of potential estrogen response element (ERE) binding sites in the promoter region of these genes to characterize their potential to be regulated by estrogen receptors (ER). Publicly available databases were used to annotate the position of these genes in the genome and to extract a 5’flanking region 2 kb upstream to 2 kb downstream of the transcription start site for transcription binding site analysis. The search for EREs and other binding sites was performed using several publicly available programs. Overall, approximately 40% of the genes analyzed were potentially able to be regulated by estrogen via ER. In addition, 17% of these genes are located very close to other genes organized in a head-to-head orientation with less than 1.0 kb between their transcript units, sharing a bidirectional promoter, and could be classified as bidirectional gene pairs. Using quantitative real-time PCR, we further investigated the effects of 17β-estradiol and antiestrogens on the expression of the bidirectional gene pairs in MCF-7 breast cancer cells. Our results showed that some of these gene pairs, such as TXNDC9/EIF5B, GALNS/TRAPPC2L, and SERINC1/PKIB, are modulated by 17β-estradiol via ER in MCF-7 breast cancer cells. Here, we also characterize the promoter region of potential ER-regulated genes and provide new information on the transcriptional regulation of bidirectional gene pairs.

Mechanisms of RON-mediated epithelial-mesenchymal transition in MDCK cells through the MAPK pathway

The epithelial-mesenchymal transition (EMT) is involved in neoplastic metastasis, and the RON protein may be involved. In the present study, we determined the role and the mechanisms of action of RON in EMT in Madin-Darby canine kidney (MDCK) cells by Western blot and cell migration analysis. Activation of RON by macrophage stimulating protein (MSP) results in cell migration and initiates changes in the morphology of RON-cDNA-transfected MDCK cells. The absence of E-cadherin, the presence of vimentin and an increase in Snail were observed in RE7 cells, which were derived from MDCK cells transfected with wt-RON, compared with MDCK cells. Stimulation of RE7 cells with MSP resulted in increased migration (about 69% of the wounded areas were covered) as well as increased activation of extracellular signal-regulated kinase 1/2 (Erk1/2) and glycogen synthase kinase-3β (GSK-3β; the percent of the activation ratio was 143.6/599.8% and 512.4%, respectively), which could be inhibited with an individual chemical inhibitor PD98059 (50 μM) specific to MAPK/ERK kinase (the percent inhibition was 98.9 and 81.2%, respectively). Thus, the results indicated that RON protein could mediate EMT in MDCK cells via the Erk1/2 pathway. Furthermore, GSK-3β regulates the function of Snail in controlling EMT by this pathway.

Polymorphism of the aryl-hydrocarbon receptor gene in intron 10 of human cancers

Polychlorinated dibenzo-p-dioxins (PCDDs) and related halogenated aromatic hydrocarbons (e.g., PCDFs), often called "dioxins", are ubiquitously present environmental contaminants. Some of them, notably 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are among the most toxic synthetic compounds known. The biological effects of dioxins are mediated via the aryl hydrocarbon receptor (AhR). Mutations in the AhR transactivation domain are linked to sensitivity to the acute lethality of TCDD. We present here a study of AhR gene polymorphism in normal and cancer human tissues affecting pre-mRNA splicing in the AhR gene-coding transactivation domain region (exon 10, intron 10, exon 11 region), previously shown to be associated with AhR dysfunction. We tested 126 pairs of normal and cancer tissue samples from liver, lung, stomach, kidney, mucous, breast, and pancreas of 49 males and 77 females (45-70 years of age). We used in vitro splicing assay, RT-PCR and sequencing methods. Our results showed that in an in vitro system it is possible to reconstitute cellular pre-mRNA splicing events. Tested cancer tissues did not contain mutations in the AhR transactivation domain region when the DNA sequences were compared with those from normal tissues. There were also no differences in AhR mRNA splice variants between normal and malignant breast tissues and no polymorphisms in the studied regions or cDNA.

BC047440 antisense eukaryotic expression vectors inhibited HepG2 cell proliferation and suppressed xenograft tumorigenicity

The biological functions of the BC047440 gene highly expressed by hepatocellular carcinoma (HCC) are unknown. The objective of this study was to reconstruct antisense eukaryotic expression vectors of the gene for inhibiting HepG2 cell proliferation and suppressing their xenograft tumorigenicity. The full-length BC047440 cDNA was cloned from human primary HCC by RT-PCR. BC047440 gene fragments were ligated with pMD18-T simple vectors and subsequent pcDNA3.1(+) plasmids to construct the recombinant antisense eukaryotic vector pcDNA3.1(+)BC047440AS. The endogenous BC047440 mRNA abundance in target gene-transfected, vector-transfected and naive HepG2 cells was semiquantitatively analyzed by RT-PCR and cell proliferation was measured by the MTT assay. Cell cycle distribution and apoptosis were profiled by flow cytometry. The in vivo xenograft experiment was performed on nude mice to examine the effects of antisense vector on tumorigenicity. BC047440 cDNA fragments were reversely inserted into pcDNA3.1(+) plasmids. The antisense vector significantly reduced the endogenous BC047440 mRNA abundance by 41% in HepG2 cells and inhibited their proliferation in vitro (P < 0.01). More cells were arrested by the antisense vector at the G1 phase in an apoptosis-independent manner (P = 0.014). Additionally, transfection with pcDNA3.1(+)BC047440AS significantly reduced the xenograft tumorigenicity in nude mice. As a novel cell cycle regulator associated with HCC, the BC047440 gene was involved in cell proliferation in vitro and xenograft tumorigenicity in vivo through apoptosis-independent mechanisms.

Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.

Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C2H2 zinc finger protein

Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.

The consensus sequence of FAMLF alternative splice variants is overexpressed in undifferentiated hematopoietic cells

The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P<0.0001). Moreover,FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs=0.317, P=0.006), hemoglobin levels (rs=0.210, P=0.049), and percentage of peripheral blood blasts (rs=0.256, P=0.027), but inversely correlated with hemoglobin levels in the control group (rs=–0.391, P<0.0001). AML patients with high CD34+ expression showed significantly higherFAMLF-CS expression than those with low CD34+ expression (P=0.041). Our results showed thatFAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Dissimilaridade genética em população segregante de soja com variabilidade para caracteres morfológicos de semente

O tegumento das sementes de soja é uma estrutura relacionada à capacidade de germinação, vigor e longevidade das sementes. Entre genótipos de soja existe variabilidade genética quanto aos caracteres do tegumento da semente, a qual pode ser utilizada em programas de melhoramento genético. Diante do exposto, realizou-se esse estudo com os objetivos de: Analisar a dissimilaridade genética de população segregante de soja para caracteres morfológicos de sementes, por meio de marcadores morfológicos e marcadores moleculares (AFLP, SSR e RAPD); Estimar a correlação entre as matrizes de dissimilaridade obtidas por meio da utilização das diferentes classes de marcadores. A população utilizada no estudo originou-se do cruzamento entre dois genótipos contrastantes para os caracteres do tegumento, a cultivar CD 202 (genitor feminino), com tegumento amarelo, e o genótipo TP (genitor masculino), com tegumento preto. Na geração F3, foram avaliados os caracteres morfológicos de cores do tegumento e do hilo, presença de derramamento de hilo, cor da pubescência e cor da flor. Os marcadores moleculares foram obtidos através das técnicas de AFLP, SSR e RAPD. De acordo com os resultados, os marcadores AFLP são os mais eficientes em acessar a variabilidade genética da população estudada, proporcionando a formação de maior número de grupos em relação aos demais marcadores. Apenas a matriz de dissimilaridade e o dendrograma obtido através de marcadores moleculares AFLP avaliados isoladamente apresentam correlação positiva com a matriz de dissimilaridade e o dendograma obtido por avaliação dos dados morfológicos.

Partial characterization of genes from the embryonic axis of Melanoxylon brauna Schott. (Leguminosae-Caesalpinioideae) seeds

The objective of this study was to partially characterize some genes involved in the desiccation tolerance of the embryonic axis of Melanoxylon brauna seeds subjected, or not, to oven fast-drying. Seeds were initially dried rapidly in an oven at 40 ºC, 50 ºC, 60 ºC, 70 ºC, and 80 °C, for 24, 48 and 72 h and then subjected to germination tests and moisture content determination. Degenerate primers were designed for 19 genes. The CDNA was used as a template for PCR amplifications using the degenerate primers, and the PCR products obtained were purified, cloned and sequenced. The seeds showed a gradual reduction in percent germination with increasing temperature and drying time. Nucleotide sequences of the cloned fragments related to genes CAT1, SPS1, Abi5, Transk and PM25 were obtained. The similarity analysis with the sequences deposited in databases revealed similarities with genes CAT1, SPS1, Transk and PM25 from other plant species. The nucleotide sequences obtained from the respective genes will be used for designing specific primers for gene expression analyses during seed germination in order to understand the causes for loss of physiological quality of Melanoxylon brauna seeds.

The osmoadaptive response of the wine yeast Saccharomyces cerevisiae K1-V1116 during icewine fermentation

The adapted metabolic response of commercial wine yeast under prolonged exposure to concentrated solutes present in Icewine juice is not fully understood. Presently, there is no information regarding the transcriptomic changes in gene expression associated with the adaptive stress response ofwine yeast during Icewine fermentation compared to table wine fermentation. To understand how and why wine yeast respond differently at the genomic level and ultimately at the metabolic level during Icewine fermentation, the focus ofthis project was to identify and compare these differences in the wine yeast Saccharomyces cerevisiae KI-Vll16 using cDNA microarray technology during the first five days of fermentation. Significant differences in yeast gene expression patterns between fermentation conditions were correlated to differences in nutrient utilization and metabolite production. Sugar consumption, nitrogen usage and metabolite levels were measured using enzyme assays and HPLC. Also, a small subset of differentially expressed genes was verified using Northern analysis. The high osmotic stress experienced by wine yeast throughout Icewine fermentation elicited changes in cell growth and metabolism correlating to several fermentation difficulties, including reduced biomass accumulation and fermentation rate. Genes associated with carbohydrate and nitrogen transport and metabolism were expressed at lower levels in Icewine juice fermenting cells compared to dilute juice fermenting cells. Osmotic stress, not nutrient availability during Icewine fermentation appears to impede sugar and nitrogen utilization. Previous studies have established that glycerol and acetic acid production are increased in yeast during Icewine fermentation. A gene encoding for a glycerollW symporter (STL1) was found to be highly expressed up to 25-fold in the i Icewine juice condition using microarray and Northern analysis. Active glycerol transport by yeast under hyperosmotic conditions to increase cytosolic glycerol concentration may contribute to reduced cell growth observed in the Icewine juice condition. Additionally, genes encoding for two acetyl CoA synthetase isoforms (ACSl and ACS2) were found to be highly expressed, 19- and II-fold respectively, in dilute juice fermenting cells relative to the Icewine juice condition. Therefore, decreased conversion of acetate to acetyl-CoA may contribute to increased acetic acid production during Icewine fermentation. These results further help to explain the response of wine yeast as they adapt to Icewine juice fermentation. ii

Isolation of DNA sequences with homology to a degenerate FaRP oligonucleotide from the crayfish Procambarus clarkii

The neuropeptide Th1RFamide with the sequence Phe-Met-Arg-Phe-amide was originally isolated in the clam Macrocallista nimbosa (price and Greenberg, 1977). Since its discovery, a large family ofFl\1RFamide-related peptides termed FaRPs have been found to be present in all major animal phyla with functions ranging from modulation of neuronal activity to alteration of muscular contractions. However, little is known about the genetics encoding these peptides, especially in invertebrates. As FaRP-encoding genes have yet to be investigated in the invertebrate Malacostracean subphylum, the isolation and characterization ofFaRP-encoding DNA and mRNA was pursued in this project. The immediate aims of this thesis were: (1) to amplify mRNA sequences of Procambarus clarkii using a degenerate oligonucleotide primer deduced from the common amino acid sequence ofisolated Procambarus FaRPS, (2) to determine if these amplification products encode FaRP gene sequences, and (3) to create a selective cDNA library of sequences recognized by the degenerate oligonucleotide primer. The polymerase chain reaction - rapid amplification of cDNA ends (PCR-RACE) is a procedure in which a single gene-specific primer is used in conjunction with a generalized 3' or 5' primer to amplify copies ofthe region between a single point in the transcript and the 3' or 5' end of cDNA of interest (Frohman et aI., 1988). PCRRACE reactions were optimized with respect to primers used, buffer composition, cycle number, nature ofgenetic substrate to be amplified, annealing, extension and denaturation temperatures and times, and use of reamplification procedures. Amplification products were cloned into plasmid vectors and recombinant products were isolated, as were the recombinant plaques formed in the selective cDNA library. Labeled amplification products were hybridized to recombinant bacteriophage to determine ligated amplification product presence. When sequenced, the five isolated PCR-RACE amplification products were determined not to possess FaRP-encoding sequences. The 200bp, 450bp, and 1500bp sequences showed homology to the Caenorhabditis elegans cosmid K09A11, which encodes for cytochrome P450; transfer-RNA; transposase; and tRNA-Tyr, while the 500bp and 750bp sequences showed homology with the complete genome of the Vaccinia virus. Under the employed amplification conditions the degenerate oligonucleotide primer was observed to bind to and to amplify sequences with either 9 or 10bp of 17bp identity. The selective cDNA library was obselVed to be of extremely low titre. When library titre was increased, white. plaques were isolated. Amplification analysis of eight isolated Agt11 sequences from these plaques indicated an absence of an insertion sequence. The degenerate 17 base oligonucleotide primer synthesized from the common amino acid sequence ofisolated Procambarus FaRPs was thus determined to be non-specific in its binding under the conditions required for its use, and to be insufficient for the isolation and identification ofFaRP-encoding sequences. A more specific primer oflonger sequence, lower degeneracy, and higher melting temperature (TJ is recommended for further investigation into the FaRP-encoding genes of Procambarlls clarkii.