Cheaper Faster Drug Development Validated By The Repositioning Of Drugs Against Neglected Tropical Diseases.

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Tradução & aprendizado de língua estrangeira: o ponto de vista do aluno

This paper reports some exemplary data related to a research project on the role of translation in foreign language teaching-learning. The data were collected through a questionnaire administered to 47 Brazilian ESL learners. Specifically, the points of the analysis are: how the translation process is conceived by the students; why and when the translation is used by the learners in classroom situations; mother tongue/foreign language relationships in this specific context, among other aspects. The findings reveal that translation, when used a mediating resource for foreign language teaching-learning, can promote target language management.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Flicker perimetry in healthy subjects: influence of age and gender, learning effect and short-term fluctuation

PURPOSE: To determine the mean critical fusion frequency and the short-term fluctuation, to analyze the influence of age, gender, and the learning effect in healthy subjects undergoing flicker perimetry. METHODS: Study 1 - 95 healthy subjects underwent flicker perimetry once in one eye. Mean critical fusion frequency values were compared between genders, and the influence of age was evaluated using linear regression analysis. Study 2 - 20 healthy subjects underwent flicker perimetry 5 times in one eye. The first 3 sessions were separated by an interval of 1 to 30 days, whereas the last 3 sessions were performed within the same day. The first 3 sessions were used to investigate the presence of a learning effect, whereas the last 3 tests were used to calculate short-term fluctuation. RESULTS: Study 1 - Linear regression analysis demonstrated that mean global, foveal, central, and critical fusion frequency per quadrant significantly decreased with age (p<0.05).There were no statistically significant differences in mean critical fusion frequency values between males and females (p>0.05), with the exception of the central area and inferonasal quadrant (p=0.049 and p=0.011, respectively), where the values were lower in females. Study 2 - Mean global (p=0.014), central (p=0.008), and peripheral (p=0.03) critical fusion frequency were significantly lower in the first session compared to the second and third sessions. The mean global short-term fluctuation was 5.06±1.13 Hz, the mean interindividual and intraindividual variabilities were 11.2±2.8% and 6.4±1.5%, respectively. CONCLUSION: This study suggests that, in healthy subjects, critical fusion frequency decreases with age, that flicker perimetry is associated with a learning effect, and that a moderately high short-term fluctuation is expected.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

O esporte paraolímpico no Brasil : abordagem da sociologia do esporte de Pierre Bourdieu

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

Incapacidades fisicas em hanseniase e atividade fisica : coisa do passado ou problema do futuro

Universidade Estadual de Campinas . Faculdade de Educação Física

Modelo de inclusão digital para construção do conhecimento em qualidade de vida e atividade fisica

Universidade Estadual de Campinas. Faculdade de Educação Física

As artes marciais chinesas para pessoas com deficiência : contextos, dilemas e possibilidades = Chinese martial arts for people with disabilities : contexts, dilemmas and possibilities

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação física e inclusão educacional : entender para atender = Physical education and educational inclusion : understanding to attend

Universidade Estadual de Campinas . Faculdade de Educação Física

O Taekwondo como modalidade paradesportiva

Universidade Estadual de Campinas . Faculdade de Educação Física