Comparison of the antidiabetic activity of Berberis lyceum root extract and berberine in alloxan-induced diabetic rats

Berberine has been shown to have hypoglycaemic activity in several in vitro and in vivo models, although the mechanism of action is not fully known. Berberis lyceum Royle root produces high concentrations of berberine, and in traditional medicine, the whole extract of this plant is used widely to treat diabetes. The antidiabetic activity of the ethanol root extract of Berberis lyceum was compared with pure berberine in normal and alloxan-diabetic rats using similar doses of each. The concentration of berberine in the extract was determined to be 80% dry weight with only trace amounts of other alkaloids present. The purpose of the study was to investigate the effects of berberine and a whole extract of Berberis lyceum on blood glucose and other parameters associated with diabetes, to compare the effects of the crude extract with those of pure berberine and thus validate its use as a therapeutic agent, and finally to identify any contribution of the other components of the extract to these effects. Oral administration of 50 mg/kg of Berberis extract and berberine to normal and experimental diabetic rats produced a significant (p < 0.05) reduction in blood glucose levels from days 3-7 days of treatment. Significant effects were also observed on the glucose tolerance, glycosylated haemoglobin, serum lipid profiles and body weight of experimental animals. Berberis extract and berberine demonstrated similar effects on all parameters measured, and although the extract was comparable in efficacy to berberine, it did not produce any effects additional to those shown by pure berberine. The results support the use of the extract in traditional medicine, and demonstrate that apart from being a highly cost-effective means of treating with berberine, the total extract does not appear to confer any additional benefits or disadvantages compared with the pure compound. Copyright (c) 2008 John Wiley & Sons, Ltd.

The multidimensional measurement of the positive symptoms of psychosis

The measures most frequently used to assess psychotic symptoms fail to reflect important dimensions. The Psychotic Symptom Rating Scale (PSYRATS) aims to capture the multidimensional nature of auditory hallucinations and delusions. Individuals (N = 276) who had recently relapsed with positive symptoms completed the auditory hallucinations and delusions PSYRATS scales. These scores were compared with the relevant items from the SAPS and PANSS, and with measures of current mood. Total scores and distribution of items of the PSYRATS scales are presented and correlated with other measures. Positive symptom items from the SAPS and PANSS reflected the more objective aspects of PSYRATS ratings of auditory hallucinations and delusions (frequency and conviction) but were relatively poor at measuring distress. A major strength of the PSYRATS scales is the specific measurement of the distress dimension of symptoms, which is a key target of psychological intervention. It is advised that the PSYRATS should not be used as a total score alone, whilst further research is needed to clarify the best use of potential subscales. Copyright (c) 2007 John Wiley & Sons, Ltd.

Effects of active information processing on the understanding of risk information

Two experiments investigated effects of active processing of risk information on participants' understanding and judgments. It was hypothesized that more active processing would lead to better understanding and differences in affective judgments (e.g. increased satisfaction and reduced perceived risk to health). In both experiments participants were given a written scenario about their being prescribed a fictitious medication. This medication was said to cause side effects in 2% of people who took it. Before answering a series of written questions, participants in the active conditions of both experiments were asked to carry out a reflective task (portraying the size of risk on a bar chart in Experiment 1 and answering a reflective question in Experiment 2). The results showed that active participants rated the likelihood of experiencing possible side effects significantly lower than passive participants (Experiment 1), and that active participants were significantly more satisfied with the information and judged perceived risk to health from taking the medication significantly lower than passive participants (Experiment 2). In both experiments, active participants were significantly more correct in their probability and frequency estimates. The studies demonstrate that active processing of risk information leads to improved understanding of the information given. This has important implications for risk communication. In the context of health, better understanding should lead to improved decision-making and health outcomes. Copyright (C) 2004 John Wiley Sons, Ltd.

Training conditional and cumulative risk judgements: the role of frequencies, problem-structure and Einstellung

Two experiments implement and evaluate a training scheme for learning to apply frequency formats to probability judgements couched in terms of percentages. Results indicate that both conditional and cumulative probability judgements can be improved in this manner, however the scheme is insufficient to promote any deeper understanding of the problem structure. In both experiments, training on one problem type only (either conditional or cumulative risk judgements) resulted in an inappropriate transfer of a learned method at test. The obstacles facing a frequency-based training programme for teaching appropriate use of probability data are discussed. Copyright (c) 2006 John Wiley & Sons, Ltd.

Training to address attitudes and behaviour of rural bank managers in Madhya Pradesh, India: a programme to facilitate financial inclusion

Given their physical presence in India, banks are arguably well-placed to improve financial inclusion in rural areas. However, uncertain repayment capacities and high transaction costs mean formal financial institutions are often reluctant to lend to the rural poor. Conversely, high transaction costs in dealing with banks are also incurred by clients, through, for example, lengthy, cumbersome and potentially ignominious procedures. Negative attitudes towards poor clients can be an important component of such transaction costs. An applied research project funded by the Enterprise Development Innovation Fund (EDIF-DFID) developed an innovative training programme designed to encourage more positive attitudes of bank staff towards poor clients, and towards their own role in rural poverty alleviation and development. This paper examines the development of the training programme, its implementation, and the results of its evaluation. It is shown that training can bring about attitudinal change, which in turn is reflected in behaviour and social impact. Copyright © 2007 John Wiley & Sons, Ltd.

Treatment of child anxiety. an exploratory study of the role of maternal anxiety and behaviours in treatment outcome

Anxiety disorders are common among parents of anxious children and have been found to impede child treatment outcomes, yet it is unclear whether it is parental anxiety that needs to be targeted in therapy or associated parental behaviours. Twenty-two children (6-12 years) with a current anxiety disorder and their mothers received cognitive-behavioural treatment (CBT) for child anxiety. In addition, of the 12 mothers who met criteria for a current anxiety disorder, 6 received CBT for their own disorder. Assessments were made of the mother-child interaction. The main findings were: (1) children did less well from treatment where their mothers had a current anxiety disorder; (2) treatment of maternal anxiety disorder did not improve child treatment outcome; and (3) maternal overinvolvement and expression of fear was associated with child treatment outcome. The results suggest that in the context of maternal anxiety disorder, child treatment outcome may be improved by specifically targeting parenting behaviours. Copyright (C) 2008 John Wiley & Sons, Ltd.

Implicit memory and consumer choice: the mediating role of brand familiarity

Two experiments investigated the influence of implicit memory on consumer choice for brands with varying levels of familiarity. Priming was measured using a consideration-choice task, developed by Coates, Butler and Berry (2004). Experiment 1 employed a coupon-rating task at encoding that required participants to meaningfully process individual brand names, to assess whether priming could affect participants' final (preferred) choices for familiar brands. Experiment 2 used this same method to assess the impact of implicit memory on consideration and choice for unknown and leader brands, presented in conjunction with familiar competitors. Significant priming was obtained in both experiments, and was shown to directly influence final choice in the case of familiar and highly familiar leader brands. Moreover, it was shown that a single prior exposure could lead participants to consider buying an unknown, and indeed fictitious, brand. Copyright (c) 2006 John Wiley & Sons, Ltd.

Reverberant auditory environments: the effects of multiple echoes on distraction by 'irrelevant' speech

Two experiments examine the effect on an immediate recall test of simulating a reverberant auditory environment in which auditory distracters in the form of speech are played to the participants (the 'irrelevant sound effect'). An echo-intensive environment simulated by the addition of reverberation to the speech reduced the extent of 'changes in state' in the irrelevant speech stream by smoothing the profile of the waveform. In both experiments, the reverberant auditory environment produced significantly smaller irrelevant sound distraction effects than an echo-free environment. Results are interpreted in terms of changing-state hypothesis, which states that acoustic content of irrelevant sound, rather than phonology or semantics, determines the extent of the irrelevant sound effect (ISE). Copyright (C) 2007 John Wiley & Sons, Ltd.

Auditory distraction from low-intensity noise: a review of the consequences for learning and workplace environments

The 'irrelevant sound effect' in short-term memory is commonly believed to entail a number of direct consequences for cognitive performance in the office and other workplaces (e.g. S. P. Banbury, S. Tremblay, W. J. Macken, & D. M. Jones, 2001). It may also help to identify what types of sound are most suitable as auditory warning signals. However, the conclusions drawn are based primarily upon evidence from a single task (serial recall) and a single population (young adults). This evidence is reconsidered from the standpoint of different worker populations confronted with common workplace tasks and auditory environments. Recommendations are put forward for factors to be considered when assessing the impact of auditory distraction in the workplace. Copyright (c) 2005 John Wiley & Sons, Ltd.

Evolution in software systems: foundations of the SPE classification scheme

The SPE taxonomy of evolving software systems, first proposed by Lehman in 1980, is re-examined in this work. The primary concepts of software evolution are related to generic theories of evolution, particularly Dawkins' concept of a replicator, to the hermeneutic tradition in philosophy and to Kuhn's concept of paradigm. These concepts provide the foundations that are needed for understanding the phenomenon of software evolution and for refining the definitions of the SPE categories. In particular, this work argues that a software system should be defined as of type P if its controlling stakeholders have made a strategic decision that the system must comply with a single paradigm in its representation of domain knowledge. The proposed refinement of SPE is expected to provide a more productive basis for developing testable hypotheses and models about possible differences in the evolution of E- and P-type systems than is provided by the original scheme. Copyright (C) 2005 John Wiley & Sons, Ltd.

A comparative study of Java and C performance in two large-scale parallel applications

In the 1990s the Message Passing Interface Forum defined MPI bindings for Fortran, C, and C++. With the success of MPI these relatively conservative languages have continued to dominate in the parallel computing community. There are compelling arguments in favour of more modern languages like Java. These include portability, better runtime error checking, modularity, and multi-threading. But these arguments have not converted many HPC programmers, perhaps due to the scarcity of full-scale scientific Java codes, and the lack of evidence for performance competitive with C or Fortran. This paper tries to redress this situation by porting two scientific applications to Java. Both of these applications are parallelized using our thread-safe Java messaging system—MPJ Express. The first application is the Gadget-2 code, which is a massively parallel structure formation code for cosmological simulations. The second application uses the finite-domain time-difference method for simulations in the area of computational electromagnetics. We evaluate and compare the performance of the Java and C versions of these two scientific applications, and demonstrate that the Java codes can achieve performance comparable with legacy applications written in conventional HPC languages. Copyright © 2009 John Wiley & Sons, Ltd.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.