Electron impact excitation of Mg VIII: Collision strengths, transition probabilities and theoretical EUV and soft X-ray line intensities for Mg VIII

Context: Mg VIII emission lines are observed in a range of astronomical objects such as the Sun, other cool stars and in the coronal line region of Seyfert galaxies. Under coronal conditions Mg VIII emits strongly in the extreme ultraviolet (EUV) and soft X-ray spectral regions which makes it an ideal ion for plasma diagnostics.

Aims. Two theoretical atomic models, consisting of 125 fine structure levels, are developed for the Mg VIII ion. The 125 levels arise from the 2s(2)2p, 2s(2)p2, 2p(3), 2s(2)3s, 2s(2)3p, 2s(2)3d, 2s2p3s, 2s2p3p, 2s2p3d, 2p(2)3s, 2p(2)3p and 2p(2)3d configurations. Electron impact excitation collision strengths and radiative transition probabilities are calculated for both Mg VIII models, compared with existing data, and the best model selected to generate a set of theoretical emission line intensities. The EUV lines, covering 312-790 angstrom, are compared with existing solar spectra (SERTS-89 and SUMER), while the soft X-ray transitions (69-97 angstrom) are examined for potential density diagnostic line ratios and also compared with the limited available solar and stellar observational data.

Methods. The R-matrix codes Breit-Pauli RMATRXI and RMATRXII are utilised, along with the PSTGF code, to calculate the collision strengths for two Mg VIII models. Collision strengths are averaged over a Maxwellian distribution to produce the corresponding effective collision strengths for use in astrophysical applications. Transition probabilities are also calculated using the CIV3 atomic structure code. The best data are then incorporated into the modelling code CLOUDY and line intensities generated for a range of electron temperatures and densities appropriate to solar and stellar coronal plasmas.

Results. The present effective collision strengths are compared with two previous calculations. Good levels of agreement are found with the most recent, but there are large differences with the other for forbidden transitions. The resulting line intensities compare favourably with the observed values from the SERTS-89 and SUMER spectra. Theoretical soft X-ray emission lines are presented and several density diagnostic line ratios examined, which are in reasonable agreement with the limited observational data available.

X-ray driven evaporation of exoplanet atmospheres: discovery of a uniquely suited test system

The evaporation of exoplanetary atmospheres is thought to be driven by high-energy irradiation. However, the actual mass loss rates are not well constrained. Co-I Kipping has recently discovered that the star KOI-314, an M1V dwarf at 65 pc distance, is orbited by two earth-sized planets, the inner one of them rocky and the outer one gaseous (P_orb = 14d and 23d). Other recent works have shown an abundance of small rocky planets in very close orbits around their host stars, suggesting that the stellar high-energy irradiation evaporates away gaseous envelopes. KOI-314 is the first nearby system in which earth-sized planets of both types are detected, allowing us to constrain the efficiency of planetary evaporation if the stellar X-ray irradiation is measured. We therefore propose a 10 ks Chandra ACIS-S pointing to determine the stellar X-ray luminosity and hardness ratio. The accuracy of the orbital solution decreases quickly due to Transit-Timing Variations, which is why we ask for DDT.

Laser-driven x-ray and neutron source development for industrial applications of plasma accelerators

Pulsed beams of energetic x-rays and neutrons from intense laser interactions with solid foils are promising for applications where bright, small emission area sources, capable of multi-modal delivery are ideal. Possible end users of laser-driven multi-modal sources are those requiring advanced non-destructive inspection techniques in industry sectors of high value commerce such as aerospace, nuclear and advanced manufacturing. We report on experimental work that demonstrates multi-modal operation of high power laser-solid interactions for neutron and x-ray beam generation. Measurements and Monte Carlo radiation transport simulations show that neutron yield is increased by a factor ∼2 when a 1 mm copper foil is placed behind a 2 mm lithium foil, compared to using a 2 cm block of lithium only. We explore x-ray generation with a 10 picosecond drive pulse in order to tailor the spectral content for radiography with medium density alloy metals. The impact of using >1 ps pulse duration on laser-accelerated electron beam generation and transport is discussed alongside the optimisation of subsequent bremsstrahlung emission in thin, high atomic number target foils. X-ray spectra are deconvolved from spectrometer measurements and simulation data generated using the GEANT4 Monte Carlo code. We also demonstrate the unique capability of laser-driven x-rays in being able to deliver single pulse high spatial resolution projection imaging of thick metallic objects. Active detector radiographic imaging of industrially relevant sample objects with a 10 ps drive pulse is presented for the first time, demonstrating that features of 200 μm size are resolved when projected at high magnification.

Composition analysis of high-Tc superconducting thin films by quantitative x-ray fluorescence

A method is presented for determining the composition of thin films containing the elements Bi, Sr, Br, Cu, and Ca. Quantitative x-ray fluorescence (XRF) consisting of radioactive sources (secondary foil excitor 241Am-Mo source and 55Pe source), a Si(Li) detector, and a multichannel analyzer were employed. The XRF system was calibrated by using sol gel thin films of known element composition and also by sputtered thin films analyzed by the conventional Rutherford Back Scattering (RBS). The XRF system has been used to assist and optimize the sputter target composition required to produce high-Tc BiSrCaCuO films with the desired metal composition.

X-ray diffraction studies of muscle : observations on the anterior byssus retractor muscle of Mytilus edulis and the insect flight muscle from Sarcophaga bullata

The interfilament spacing of the anterior byssus retractor muscle from Mytilus edulis was studied as the muscle was extended. It was found that variations in this spacing were very small and consistent with the hypothesis that the interfilament spacing was independent of the extension of the muscle. It was observed that the interfilament spacing was dependent on the osmolarity of the bathing medium. In concentrated solutions of the artificial seawater, the interfilament spacing decreased; while in dilute solutions of artificial seawater, it was observed that the interfilament spacing was increasing. X-ray diffraction patterns were obtained from fresh, and glutaraldehyde fixed, specimens of insect flight muscle from Sarcophaga bullata. There patterns were in general agreement with previous X-ray diffraction studies of insect flight muscle. A reflexion G at 93A was observed and interpreted as arising from diffraction in the mitochondria. Specimens of dried insect flight muscle produced a diffraction pattern consisting of arc and ring reflexions. This was interpreted as suggesting an ordered arrangement of cristae, in the mitochondria from these muscles.

Nuclear charge radii from X-ray transitions in muonic atoms of carbon, nitrogen and oxygen

Energies of muonic X-rays of the K-series of carbon, nitrogen and oxygen have been measured with an accuracy of about 15 eV. Root mean square radii of the nuclear charge distributions were deduced. The results 2.49±0.05 fm for carbon, 2.55 ±0.03 fm for nitrogen and 2.71 ±0.02 fm for oxygen are in good agreement at comparable accuracy with recent electron scattering data.

Low-molecular-weight gelators: Elucidating the principles of gelation based on gelator solubility and a cooperative self-assembly model

This paper highlights the key role played by solubility in influencing gelation and demonstrates that many facets of the gelation process depend on this vital parameter. In particular, we relate thermal stability (T-gel) and minimum gelation concentration (MGC) values of small-molecule gelation in terms of the solubility and cooperative self-assembly of gelator building blocks. By employing a van't Hoff analysis of solubility data, determined from simple NMR measurements, we are able to generate T-calc values that reflect the calculated temperature for complete solubilization of the networked gelator. The concentration dependence of T-calc allows the previously difficult to rationalize "plateau-region" thermal stability values to be elucidated in terms of gelator molecular design. This is demonstrated for a family of four gelators with lysine units attached to each end of an aliphatic diamine, with different peripheral groups (Z or Bee) in different locations on the periphery of the molecule. By tuning the peripheral protecting groups of the gelators, the solubility of the system is modified, which in turn controls the saturation point of the system and hence controls the concentration at which network formation takes place. We report that the critical concentration (C-crit) of gelator incorporated into the solid-phase sample-spanning network within the gel is invariant of gelator structural design. However, because some systems have higher solubilities, they are less effective gelators and require the application of higher total concentrations to achieve gelation, hence shedding light on the role of the MGC parameter in gelation. Furthermore, gelator structural design also modulates the level of cooperative self-assembly through solubility effects, as determined by applying a cooperative binding model to NMR data. Finally, the effect of gelator chemical design on the spatial organization of the networked gelator was probed by small-angle neutron and X-ray scattering (SANS/SAXS) on the native gel, and a tentative self-assembly model was proposed.

X-ray crystallographic study of DNA duplex cross-linking: simultaneous binding to two d(CGTACG)(2) molecules by a bis(9-aminoacridine-4-carboxamide) derivative

Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Object-based three-dimensional X-ray imaging

A form of three-dimensional X-ray imaging, called Object 3-D, is introduced, where the relevant subject material is represented as discrete ‘objects’. The surface of each such object is derived accurately from the projections of its outline, and of its other discontinuities, in about ten conventional X-ray views, distributed in solid angle. This technique is suitable for many applications, and permits dramatic savings in radiation exposure and in data acquisition and manipulation. It is well matched to user-friendly interactive displays.

Synthesis and X-ray crystal structure of the triethylammonium magnesium β-octamolybdate(VI)salt[Et3NH]2[Mg(H2O)6Mo8O26]·2H2O

[Et3NH]4[Mo8O26] reacted with MgCl2 giving the triethylammonum magnesium β-octamolybdate(VI) salt [Et3NH]2[Mg(H2O)6Mo8O26]·2H2O (3) and the triethylammonium hydronium β-octaamolybdate(VI) salt [Et3NH]3[(H3O)Mo8O26·2H2O (4), respectively. A small amount of [Et3NH]2[Mo6O269] was formed as a by-product. The salts 3 and 4 were characterized by X-ray crystallography. The [Mg(H2O)6Mo8O26]2− moiety in 3 is polymeric, with each octahedral [Mg(H2O)6]2+ ion sandwiched between two β[Mo8O26]4− ions, being hydrogen bonded to three terminal MOO oxygen atoms on one face of each β[Mo8O26]4− ion. The X-ray crystal structure of 4 corresponds to the reported previously. IR and conductivity data are given for 3 and 4.

Fulvalene cyclopentadienyl titanium and zirconium(III) and -(IV) complexes. X-Ray crystal structure of [{Ti(η5-C5H5) Cl}2 (μ-O)(μ-η5-η5-C10H8)]

The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M  Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.

Coupling between mesogenic units and polymer backbone in side-chain liquid crystal polymers and elastomers

The levels of alignment of the mesogenic units and of the polymer backbone trajectory for polyacrylate based nematic side-chain liquid crystal polymers and elastomers were evaluated by using wide angle X-ray and small angle neutron scattering procedures. The X-ray scattering measurements show that substantial levels of preferred orientation of the mesogenic units may be introduced through magnetic fields for uncrosslinked polymers and through mechanical extension for liquid crystal elastomers. Small angle neutron scattering measurements show that for highly aligned samples an anisotropic polymer backbone trajectory is observed in which the envelope is slightly extended by ∼ 10% in the direction parallel to the axis of alignment of the mesogenic units. The sense of this coupling differs from that recorded for other uncrosslinked side-chain liquid crystal polymers. Possible mechanisms to account for this anisotropy and its relationship to the properties of liquid crystal elastomers are discussed. The observed deformation behaviour of the liquid crystal elastomer is non-affine and this appears to confirm the dominating influence of the liquid crystal order of the side chains on the mechanical properties of these novel networks.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Precession and nutation in the eta Carinae binary system: evidence from the X-ray light curve

It is believed that eta Carinae is actually a massive binary system, with the wind-wind interaction responsible for the strong X-ray emission. Although the overall shape of the X-ray light curve can be explained by the high eccentricity of the binary orbit, other features like the asymmetry near periastron passage and the short quasi-periodic oscillations seen at those epochs have not yet been accounted for. In this paper we explain these features assuming that the rotation axis of eta Carinae is not perpendicular to the orbital plane of the binary system. As a consequence, the companion star will face eta Carinae on the orbital plane at different latitudes for different orbital phases and, since both the mass-loss rate and the wind velocity are latitude dependent, they would produce the observed asymmetries in the X-ray flux. We were able to reproduce the main features of the X-ray light curve assuming that the rotation axis of eta Carinae forms an angle of 29 degrees +/- 4 degrees with the axis of the binary orbit. We also explained the short quasi-periodic oscillations by assuming nutation of the rotation axis, with an amplitude of about 5 degrees and a period of about 22 days. The nutation parameters, as well as the precession of the apsis, with a period of about 274 years, are consistent with what is expected from the torques induced by the companion star.