Evaluation of stunned and infarcted canine myocardium by real time myocardial contrast echocardiography

Differentiation between stunned and infarcted myocardium in the setting of acute ischemia is challenging. Real time myocardial contrast echocardiography allows the simultaneous assessment of myocardial perfusion and function. In the present study we evaluated infarcted and stunned myocardium in an experimental model using real time myocardial contrast echocardiography. Sixteen dogs underwent 180 min of coronary occlusion followed by reperfusion (infarct model) and seven other dogs were submitted to 20 min of coronary occlusion followed by reperfusion (stunned model). Wall motion abnormality and perfusional myocardial defect areas were measured by planimetry. Risk and infarct areas were determined by tissue staining. In the infarct model, the wall motion abnormality area during coronary occlusion (5.52 ± 1.14 cm²) was larger than the perfusional myocardial defect area (3.71 ± 1.45 cm²; P < 0.001). Reperfusion resulted in maintenance of wall motion abnormality (5.45 ± 1.41 cm²; P = 0.43 versus occlusion) and reduction of perfusional myocardial defect (1.51 ± 1.29 cm²; P = 0.004 versus occlusion). Infarct size determined by contrast echocardiography correlated with tissue staining (r = 0.71; P = 0.002). In the stunned model, the wall motion abnormality area was 5.49 ± 0.68 cm² during occlusion and remained 5.1 ± 0.63 cm² after reperfusion (P = 0.07). Perfusional defect area was 2.43 ± 0.79 cm² during occlusion and was reduced to 0.2 ± 0.53 cm² after reperfusion (P = 0.04). 2,3,5-Triphenyl tetrazolium chloride staining confirmed the absence of necrotic myocardium in all dogs in the stunned model. Real time myocardial contrast echocardiography is a noninvasive technique capable of distinguishing between stunned and infarcted myocardium after acute ischemia.

Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Novel virtual environment and real-time simulation based methods for improving life-cycle efficiency of non-road mobile machinery

Virtual environments and real-time simulators (VERS) are becoming more and more important tools in research and development (R&D) process of non-road mobile machinery (NRMM). The virtual prototyping techniques enable faster and more cost-efficient development of machines compared to use of real life prototypes. High energy efficiency has become an important topic in the world of NRMM because of environmental and economic demands. The objective of this thesis is to develop VERS based methods for research and development of NRMM. A process using VERS for assessing effects of human operators on the life-cycle efficiency of NRMM was developed. Human in the loop simulations are ran using an underground mining loader to study the developed process. The simulations were ran in the virtual environment of the Laboratory of Intelligent Machines of Lappeenranta University of Technology. A physically adequate real-time simulation model of NRMM was shown to be reliable and cost effective in testing of hardware components by the means of hardware-in-the-loop (HIL) simulations. A control interface connecting integrated electro-hydraulic energy converter (IEHEC) with virtual simulation model of log crane was developed. IEHEC consists of a hydraulic pump-motor and an integrated electrical permanent magnet synchronous motorgenerator. The results show that state of the art real-time NRMM simulators are capable to solve factors related to energy consumption and productivity of the NRMM. A significant variation between the test drivers is found. The results show that VERS can be used for assessing human effects on the life-cycle efficiency of NRMM. HIL simulation responses compared to that achieved with conventional simulation method demonstrate the advances and drawbacks of various possible interfaces between the simulator and hardware part of the system under study. Novel ideas for arranging the interface are successfully tested and compared with the more traditional one. The proposed process for assessing the effects of operators on the life-cycle efficiency will be applied for wider group of operators in the future. Driving styles of the operators can be analysed statistically from sufficient large result data. The statistical analysis can find the most life-cycle efficient driving style for the specific environment and machinery. The proposed control interface for HIL simulation need to be further studied. The robustness and the adaptation of the interface in different situations must be verified. The future work will also include studying the suitability of the IEHEC for different working machines using the proposed HIL simulation method.

Bioeffects of albumin-encapsulated microbubbles and real-time myocardial contrast echocardiography in an experimental canine model

Myocardial contrast echocardiography has been used for assessing myocardial perfusion. Some concerns regarding its safety still remain, mainly regarding the induction of microvascular alterations. We sought to determine the bioeffects of microbubbles and real-time myocardial contrast echocardiography (RTMCE) in a closed-chest canine model. Eighteen mongrel dogs were randomly assigned to two groups. Nine were submitted to continuous intravenous infusion of perfluorocarbon-exposed sonicated dextrose albumin (PESDA) plus continuous imaging using power pulse inversion RTMCE for 180 min, associated with manually deflagrated high-mechanical index impulses. The control group consisted of 3 dogs submitted to continuous imaging using RTMCE without PESDA, 3 dogs received PESDA alone, and 3 dogs were sham-operated. Hemodynamics and cardiac rhythm were monitored continuously. Histological analysis was performed on cardiac and pulmonary tissues. No hemodynamic changes or cardiac arrhythmias were observed in any group. Normal left ventricular ejection fraction and myocardial perfusion were maintained throughout the protocol. Frequency of mild and focal microhemorrhage areas in myocardial and pulmonary tissue was similar in PESDA plus RTMCE and control groups. The percentages of positive microscopical fields in the myocardium were 0.4 and 0.7% (P = NS) in the PESDA plus RTMCE and control groups, respectively, and in the lungs they were 2.1 and 1.1%, respectively (P = NS). In this canine model, myocardial perfusion imaging obtained with PESDA and RTMCE was safe, with no alteration in cardiac rhythm or left ventricular function. Mild and focal myocardial and pulmonary microhemorrhages were observed in both groups, and may be attributed to surgical tissue manipulation.

Cytosine arabinoside-metabolizing enzyme genes are underexpressed in children with MLL gene-rearranged acute lymphoblastic leukemia

Infant acute lymphoblastic leukemia (IALL) is characterized by mixed lineage leukemia (MLL) gene rearrangements, unique gene expression profiles, poor prognosis, and drug resistance. One exception is cytosine arabinoside (Ara-C) to which IALL cells seem to be more sensitive. We quantified mRNA expression of Ara-C key enzymes in leukemic lymphoblasts from 64 Brazilian ALL children, 15 of them presenting MLL gene rearrangement, and correlated it with clinical and biological features. The diagnosis was based on morphological criteria and immunophenotyping using monoclonal antibodies. MLL gene rearrangements were detected by conventional cytogenetic analysis, RT-PCR and/or fluorescence in situ hybridization. The DCK and HENT1 expression levels were determined by real-time quantitative PCR using SYBR Green I. Relative quantification was made by the standard curve method. The results were analyzed by Mann-Whitney and Fisher exact tests. A P value of £0.05 was considered to be statistically significant. DCK and HENT1 expression levels were significantly lower in children with MLL gene-rearranged ALL compared to children with MLL germ line ALL (P = 0.0003 and 0.03, respectively). Our results differ from previous ones concerning HENT1 mRNA expression that observed a higher expression level in MLL gene-rearranged leukemias. In conclusion, the expression of the genes related to Ara-C metabolism was lower in MLL-positive children in the sample studied, suggesting the presence of population differences in the expression profile of these genes especially for HENT1.

Dynamic expression of desmin, α-SMA and TGF-β1 during hepatic fibrogenesis induced by selective bile duct ligation in young rats

We previously described a selective bile duct ligation model to elucidate the process of hepatic fibrogenesis in children with biliary atresia or intrahepatic biliary stenosis. Using this model, we identified changes in the expression of alpha smooth muscle actin (α-SMA) both in the obstructed parenchyma and in the hepatic parenchyma adjacent to the obstruction. However, the expression profiles of desmin and TGF-β1, molecules known to be involved in hepatic fibrogenesis, were unchanged when analyzed by semiquantitative polymerase chain reaction (RT-PCR). Thus, the molecular mechanisms involved in the modulation of liver fibrosis in this experimental model are not fully understood. This study aimed to evaluate the molecular changes in an experimental model of selective bile duct ligation and to compare the gene expression changes observed in RT-PCR and in real-time quantitative PCR (qRT‐PCR). Twenty-eight Wistar rats of both sexes and weaning age (21-23 days old) were used. The rats were separated into groups that were assessed 7 or 60 days after selective biliary duct ligation. The expression of desmin, α-SMA and TGF-β1 was examined in tissue from hepatic parenchyma with biliary obstruction (BO) and in hepatic parenchyma without biliary obstruction (WBO), using RT-PCR and qRT‐PCR. The results obtained in this study using these two methods were significantly different. The BO parenchyma had a more severe fibrogenic reaction, with increased α-SMA and TGF-β1 expression after 7 days. The WBO parenchyma presented a later, fibrotic response, with increased desmin expression 7 days after surgery and increased α-SMA 60 days after surgery. The qRT‐PCR technique was more sensitive to expression changes than the semiquantitative method.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Real-time simulation of multibody systems with applications for working mobile vehicles

This dissertation describes an approach for developing a real-time simulation for working mobile vehicles based on multibody modeling. The use of multibody modeling allows comprehensive description of the constrained motion of the mechanical systems involved and permits real-time solving of the equations of motion. By carefully selecting the multibody formulation method to be used, it is possible to increase the accuracy of the multibody model while at the same time solving equations of motion in real-time. In this study, a multibody procedure based on semi-recursive and augmented Lagrangian methods for real-time dynamic simulation application is studied in detail. In the semirecursive approach, a velocity transformation matrix is introduced to describe the dependent coordinates into relative (joint) coordinates, which reduces the size of the generalized coordinates. The augmented Lagrangian method is based on usage of global coordinates and, in that method, constraints are accounted using an iterative process. A multibody system can be modelled as either rigid or flexible bodies. When using flexible bodies, the system can be described using a floating frame of reference formulation. In this method, the deformation mode needed can be obtained from the finite element model. As the finite element model typically involves large number of degrees of freedom, reduced number of deformation modes can be obtained by employing model order reduction method such as Guyan reduction, Craig-Bampton method and Krylov subspace as shown in this study The constrained motion of the working mobile vehicles is actuated by the force from the hydraulic actuator. In this study, the hydraulic system is modeled using lumped fluid theory, in which the hydraulic circuit is divided into volumes. In this approach, the pressure wave propagation in the hoses and pipes is neglected. The contact modeling is divided into two stages: contact detection and contact response. Contact detection determines when and where the contact occurs, and contact response provides the force acting at the collision point. The friction between tire and ground is modelled using the LuGre friction model, which describes the frictional force between two surfaces. Typically, the equations of motion are solved in the full matrices format, where the sparsity of the matrices is not considered. Increasing the number of bodies and constraint equations leads to the system matrices becoming large and sparse in structure. To increase the computational efficiency, a technique for solution of sparse matrices is proposed in this dissertation and its implementation demonstrated. To assess the computing efficiency, augmented Lagrangian and semi-recursive methods are implemented employing a sparse matrix technique. From the numerical example, the results show that the proposed approach is applicable and produced appropriate results within the real-time period.

Real-time adaptive control of ultra-fast laser scribing process with spectrometer online monitoring

There exist several researches and applications about laser welding monitoring and parameter control but not a single one have been created for controlling of laser scribing processes. Laser scribing is considered to be very fast and accurate process and thus it would be necessary to develop accurate turning and monitoring system for such a process. This research focuses on finding out whether it would be possible to develop real-time adaptive control for ultra-fast laser scribing processes utilizing spectrometer online monitoring. The thesis accurately presents how control code for laser parameter tuning is developed using National Instrument's LabVIEW and how spectrometer is being utilized in online monitoring. Results are based on behavior of the control code and accuracy of the spectrometer monitoring when scribing different steel materials. Finally control code success is being evaluated and possible development ideas for future are presented.

Real-time monitoring of laser scribing process utilizing high-speed camera

Currently, laser scribing is growing material processing method in the industry. Benefits of laser scribing technology are studied for example for improving an efficiency of solar cells. Due high-quality requirement of the fast scribing process, it is important to monitor the process in real time for detecting possible defects during the process. However, there is a lack of studies of laser scribing real time monitoring. Commonly used monitoring methods developed for other laser processes such a laser welding, are sufficient slow and existed applications cannot be implemented in fast laser scribing monitoring. The aim of this thesis is to find a method for laser scribing monitoring with a high-speed camera and evaluate reliability and performance of the developed monitoring system with experiments. The laser used in experiments is an IPG ytterbium pulsed fiber laser with 20 W maximum average power and Scan head optics used in the laser is Scanlab’s Hurryscan 14 II with an f100 tele-centric lens. The camera was connected to laser scanner using camera adapter to follow the laser process. A powerful fully programmable industrial computer was chosen for executing image processing and analysis. Algorithms for defect analysis, which are based on particle analysis, were developed using LabVIEW system design software. The performance of the algorithms was analyzed by analyzing a non-moving image from the scribing line with resolution 960x20 pixel. As a result, the maximum analysis speed was 560 frames per second. Reliability of the algorithm was evaluated by imaging scribing path with a variable number of defects 2000 mm/s when the laser was turned off and image analysis speed was 430 frames per second. The experiment was successful and as a result, the algorithms detected all defects from the scribing path. The final monitoring experiment was performed during a laser process. However, it was challenging to get active laser illumination work with the laser scanner due physical dimensions of the laser lens and the scanner. For reliable error detection, the illumination system is needed to be replaced.

Real-Time Automatic Object Classification and Tracking using Genetic Programming and NVIDIA R CUDA TM

Genetic Programming (GP) is a widely used methodology for solving various computational problems. GP's problem solving ability is usually hindered by its long execution times. In this thesis, GP is applied toward real-time computer vision. In particular, object classification and tracking using a parallel GP system is discussed. First, a study of suitable GP languages for object classification is presented. Two main GP approaches for visual pattern classification, namely the block-classifiers and the pixel-classifiers, were studied. Results showed that the pixel-classifiers generally performed better. Using these results, a suitable language was selected for the real-time implementation. Synthetic video data was used in the experiments. The goal of the experiments was to evolve a unique classifier for each texture pattern that existed in the video. The experiments revealed that the system was capable of correctly tracking the textures in the video. The performance of the system was on-par with real-time requirements.

Development and use of a multiplex real-time quantitative polymerase chain reaction assay for detection and differentiation of Porcine circovirus-2 genotypes 2a and 2b in an epidemiological survey.

By the end of 2004, the Canadian swine population had experienced a severe 2 increase in the incidence of Porcine circovirus-associated disease (PCVAD), a problem that was 3 associated with the emergence of a new Porcine circovirus-2 genotype (PCV-2b), previously 4 unrecovered in North America. Thus it became important to develop a diagnostic tool that could 5 differentiate between the old and new circulating genotypes (PCV-2a and -2b, respectively). 6 Consequently, a multiplex real-time quantitative polymerase chain reaction (mrtqPCR) assay that 7 could sensitively and specifically identify and differentiate PCV-2 genotypes was developed. A 8 retrospective epidemiological survey that used the mrtqPCR assay was performed to determine if 9 cofactors could affect the risk of PCVAD. From 121 PCV-2–positive cases gathered for this 10 study, 4.13%, 92.56% and 3.31% were positive for PCV-2a, PCV-2b, and both genotypes, 11 respectively. In a data analysis using univariate logistic regressions, PCVAD compatible 12 (PCVAD/c) score was significantly associated with the presence of Porcine reproductive and 13 respiratory syndrome virus (PRRSV), PRRSV viral load, PCV-2 viral load, and PCV-2 14 immunohistochemistry (IHC) results. Polytomous logistic regression analysis revealed that 15 PCVAD/c score was affected by PCV-2 viral load (P = 0.0161) and IHC (P = 0.0128), but not by 16 the PRRSV variables (P > 0.9); suggesting that mrtqPCR in tissue is a reliable alternative to IHC. 17 Logistic regression analyses revealed that PCV-2 increased the odds ratio of isolating 2 major 18 swine pathogens of the respiratory tract, Actinobacillus pleuropneumoniae and Streptococcus 19 suis serotypes 1/2, 1, 2, 3, 4, and 7, which are serotypes commonly associated with clinical 20 diseases.

Data Security in Fault Tolerant Hard Real Time Systems- Use of Time Dependant Multiple Random Cipher Code

The present research problem is to study the existing encryption methods and to develop a new technique which is performance wise superior to other existing techniques and at the same time can be very well incorporated in the communication channels of Fault Tolerant Hard Real time systems along with existing Error Checking / Error Correcting codes, so that the intention of eaves dropping can be defeated. There are many encryption methods available now. Each method has got it's own merits and demerits. Similarly, many crypt analysis techniques which adversaries use are also available.

Permutation entropy based real-time chatter detection using audio signal in turning process

Machine tool chatter is an unfavorable phenomenon during metal cutting, which results in heavy vibration of cutting tool. With increase in depth of cut, the cutting regime changes from chatter-free cutting to one with chatter. In this paper, we propose the use of permutation entropy (PE), a conceptually simple and computationally fast measurement to detect the onset of chatter from the time series using sound signal recorded with a unidirectional microphone. PE can efficiently distinguish the regular and complex nature of any signal and extract information about the dynamics of the process by indicating sudden change in its value. Under situations where the data sets are huge and there is no time for preprocessing and fine-tuning, PE can effectively detect dynamical changes of the system. This makes PE an ideal choice for online detection of chatter, which is not possible with other conventional nonlinear methods. In the present study, the variation of PE under two cutting conditions is analyzed. Abrupt variation in the value of PE with increase in depth of cut indicates the onset of chatter vibrations. The results are verified using frequency spectra of the signals and the nonlinear measure, normalized coarse-grained information rate (NCIR).

Real Time Raga Detection and Analysis Using Computer

Department of Computer Applications, Cochin University of Science and Technology