Development of a Conductometric Test for Frost Resistance of Concrete, HR-272, 1988

Research is described that was aimed at developing a test method which can be reasonably and rapidly performed in the laboratory and in the field to predict, with a high degree of certainty, the behavior of concrete subjected to the action of alternate freezing and thawing. The conductometric evaluation of concrete durability was explored with 3 different test methods: conductometric evaluation of the resistance of concrete to rapid freezing and thawing; conductomtric evaluation of the resistance of concrete to natural freezing and thawing, and conductometric evaluation of the pore size distribution of concrete and its correlation to concrete durability. The study showed that conductance could be used as a viable method for determining the durability of portland cement concrete. This would also allow the continuous monitoring of concrete durability without the removal twice per week from the freeze/thaw chamber. Recommendations for the continued development of these test methods are also included.

Test result-based sampling: an efficient design for estimating the accuracy of patient safety indicators.

OBJECTIVE: Accuracy studies of Patient Safety Indicators (PSIs) are critical but limited by the large samples required due to low occurrence of most events. We tested a sampling design based on test results (verification-biased sampling [VBS]) that minimizes the number of subjects to be verified. METHODS: We considered 3 real PSIs, whose rates were calculated using 3 years of discharge data from a university hospital and a hypothetical screen of very rare events. Sample size estimates, based on the expected sensitivity and precision, were compared across 4 study designs: random and VBS, with and without constraints on the size of the population to be screened. RESULTS: Over sensitivities ranging from 0.3 to 0.7 and PSI prevalence levels ranging from 0.02 to 0.2, the optimal VBS strategy makes it possible to reduce sample size by up to 60% in comparison with simple random sampling. For PSI prevalence levels below 1%, the minimal sample size required was still over 5000. CONCLUSIONS: Verification-biased sampling permits substantial savings in the required sample size for PSI validation studies. However, sample sizes still need to be very large for many of the rarer PSIs.

Expressed isolated integrin beta1 subunit cytodomain induces endothelial cell death secondary to detachment.

Expression of isolated beta integrin cytoplasmic domains in cultured endothelial cells was reported to induce cell detachment and death. To test whether cell death was the cause or the consequence of cell detachment, we expressed isolated integrin beta1 cytoplasmic and transmembrane domains (CH1) in cultured human umbilical vein endothelial cells (HUVEC), and monitored detachment, viability, caspase activation and signaling. CH1 expression induced dose-dependent cell detachment. At 24 h over 90% of CH1-expressing HUVEC were detached but largely viable (>85%). No evidence of pro-caspase-8,-3, and PARP cleavage or suppression of phosphorylation of ERK, PKB and Ikappa-B was observed. The caspase inhibitor z-VAD did not prevent cell detachment. At 48 h, however, CH1-expressing cells were over 50% dead. As a comparison trypsin-mediated detachment resulted in a time-dependent cell death, paralleled by caspase-3 activation and suppression of ERK, PKB and Ikappa-B phosphoyrylation at 24 h or later after detachment. HUVEC stimulation with agents that strengthen integrin-mediated adhesion (i.e. PMA, the Src inhibitor PP2 and COMP-Ang1) did not prevent CH1-induced detachment. Expression of CH1 in rat carotid artery endothelial cells in vivo caused endothelial cell detachment and increased nuclear DNA fragmentation among detached cells. A construct lacking the integrin cytoplasmic domain (CH2) had no effect on adhesion and cell viability in vitro and in vivo. These results demonstrate that isolated beta1 cytoplasmic domain expression induces caspase-independent detachment of viable endothelial cells and that death is secondary to detachment (i.e. anoikis). They also reveal an essential role for integrins in the adhesion and survival of quiescent endothelial cells in vivo.

Innovative Leak Test for Pavement Joint Seals, Progress Report, HR-318, 1993

Premature failure of concrete pavement contraction joint seals is an ongoing and costly problem for the Iowa Department of Transportation. Several joint seal test sections consisting of variations in sawing methods, joint cleaning techniques, sealant installation, and sealant types have been established over the past few years. Laboratory analysis and field inspections were done as a part of the tests, and core samples were taken for laboratory adhesion pull tests. Such methods often cover specifically small areas and may not expose hidden failures. Some tests are also labor-intensive and destructive, especially that of coring. An innovative, nondestructive, broad coverage joint seal tester that yields quick results has been designed and developed for evaluation of pavement joint seal performance. The Iowa vacuum joint seal tester (IA-VAC) applies a low vacuum above a joint seal that has been spray-covered with a foaming water solution. Any unsealed area or leak that exists along the joint will become quickly and clearly visible by the development of bubbles at the leak point. By analyzing the results from the IA-VAC tests, information on the number and types of leaks can be obtained; such information will help identify the source of the problem and direct efforts toward a solution.

A Study of the Reliability of the ASTM C-666 Freeze-Thaw Test, MLR-72-01 and R-252, 1972

The Iowa State Highway Commission purchased a Conrad automatic freeze and thaw machine and placed it in operation during October 1961. There were a few problems, but considering, the many electrical and mechanical devices used in the automatic system it has always functioned quite well. Rapid freezing and thawing of 4"x4"xl8" concrete beams has been conducted primarily in accordance with ASTM C-29l (now ASTM C-666 procedure B) at the rate of one beam per day. Over 4000 beams have been tested since 1961, with determination of the resulting durability factors. Various methods of curing were used and a standard 90 day moist cure was selected. This cure seemed to yield durability factors that correlated very well with ratings of coarse aggregates based on service records. Some concrete beams had been made using the same coarse aggregate and the durability factors compared relatively well with previous tests. Durability factors seemed to yield reasonable results until large variations in durability factors were noted from beams of identical concrete mix proportions in research projects R-234 and R-247. This then presents the question "How reliable is the durability as determined by ASTM C-666?" This question became increasingly more important when a specification requiring a minimum durability factor for P.C. concrete made from coarse aggregates was incorporated into the 1972 Standard Specification for coarse aggregates for concrete.

Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Reproductive bribing and policing as evolutionary mechanisms for the suppression of within-group selfishness.

We show that a new, simple, and robust general mechanism for the social suppression of within-group selfishness follows from Hamilton's rule applied in a multilevel selection approach to asymmetrical, two-person groups: If it pays a group member to behave selfishly (i.e., increase its share of the group's reproduction, at the expense of group productivity), then its partner will virtually always be favored to provide a reproductive "bribe" sufficient to remove the incentive for the selfish behavior. The magnitude of the bribe will vary directly with the number of offspring (or other close kin) potentially gained by the selfish individual and inversely with both the relatedness r between the interactants and the loss in group productivity because of selfishness. This bribe principle greatly extends the scope for cooperation within groups. Reproductive bribing is more likely to be favored over social policing for dominants rather than subordinates and as intragroup relatedness increases. Finally, analysis of the difference between the group optimum for an individual's behavior and the individual's inclusive fitness optimum reveals a paradoxical feedback loop by which bribing and policing, while nullifying particular selfish acts, automatically widen the separation of individual and group optima for other behaviors (i.e., resolution of one conflict intensifies others).

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Comparison of fat suppression strategies in 3D spiral coronary magnetic resonance angiography.

PURPOSE: In the present study, the impact of the two different fat suppression techniques was investigated for free breathing 3D spiral coronary magnetic resonance angiography (MRA). As the coronary arteries are embedded in epicardial fat and are adjacent to myocardial tissue, magnetization preparation such as T(2)-preparation and fat suppression is essential for coronary discrimination. MATERIALS AND METHODS: Fat-signal suppression in three-dimensional (3D) thin- slab coronary MRA based on a spiral k-space data acquisition can either be achieved by signal pre-saturation using a spectrally selective inversion recovery pre-pulse or by spectral-spatial excitation. In the present study, the performance of the two different approaches was studied in healthy subjects. RESULTS: No significant objective or subjective difference was found between the two fat suppression approaches. CONCLUSION: Spectral pre-saturation seems preferred for coronary MRA applications due to the ease of implementation and the shorter cardiac acquisition window.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Evolutionary dynamics of interlinked public goods traits: an experimental study of siderophore production in Pseudomonas aeruginosa.

Public goods cooperation is common in microbes, and there is much interest in understanding how such traits evolve. Research in recent years has identified several important factors that shape the evolutionary dynamics of such systems, yet few studies have investigated scenarios involving interactions between multiple public goods. Here, we offer general predictions about the evolutionary trajectories of two public goods traits having positive, negative or neutral regulatory influence on one another's expression, and we report on a test of some of our predictions in the context of Pseudomonas aeruginosa's production of two interlinked iron-scavenging siderophores. First, we confirmed that both pyoverdine and pyochelin siderophores do operate as public goods under appropriate environmental conditions. We then tracked their production in lines experimentally evolved under different iron-limitation regimes known to favour different siderophore expression profiles. Under strong iron limitation, where pyoverdine represses pyochelin, we saw a decline in pyoverdine and a concomitant increase in pyochelin - consistent with expansion of pyoverdine-defective cheats derepressed for pyochelin. Under moderate iron limitation, pyochelin declined - again consistent with an expected cheat invasion scenario - but there was no concomitant shift in pyoverdine because cross-suppression between the traits is unidirectional only. Alternating exposure to strong and moderate iron limitation caused qualitatively similar though lesser shifts compared to the constant-environment regimes. Our results confirm that the regulatory interconnections between public goods traits can significantly modulate the course of evolution, yet also suggest how we can start to predict the impacts such complexities will have on phenotypic divergence and community stability.