942 resultados para Regulatory T Cells


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Many studies have characterized the transmembrane signaling events initiated after T-cell antigen receptor recognition of major histocompatibility complex (MHC)-bound peptides. Yet, little is known about signal transduction from a set of MHC class I recognizing receptors on natural killer (NK) cells whose ligation dramatically inhibits NK cell-mediated killing. In this study we evaluated the influence of MHC recognition on the proximal signaling events in NK cells binding tumor targets. We utilized two experimental models where NK cell-mediated cytotoxicity was fully inhibited by the recognition of specific MHC class I molecules. NK cell binding to either class I-deficient or class I-transfected target cells initiated rapid protein tyrosine kinase activation. In contrast, whereas NK cell binding to class I-deficient targets led to inositol phosphate release and increased intracellular free calcium ([Ca2+]i), NK recognition of class I-bearing targets did not induce the activation of these phospholipase C-dependent signaling events. The recognition of class I by NK cells clearly had a negative regulatory effect since blocking this interaction using anti-class I F(ab')2 fragments increased inositol 1,4,5-trisphosphate release and [Ca2+]i and increased the lysis of the targets. These results suggest that one of the mechanisms by which NK cell recognition of specific MHC class I molecules can block the development of cell-mediated cytotoxicity is by inhibiting specific critical signaling events.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mast cells are multifunctional bone marrow-derived cells found in mucosal and connective tissues and in the nervous system, where they play important roles in tissue inflammation and in neuroimmune interactions. Very little is known about endogenous molecules and mechanisms capable of modulating mast cell activation. Palmitoylethanolamide, found in peripheral tissues, has been proposed to behave as a local autacoid capable of downregulating mast cell activation and inflammation. A cognate N-acylamide, anandamide, the ethanolamide of arachidonic acid, occurs in brain and is a candidate endogenous agonist for the central cannabinoid receptor (CB1). As a second cannabinoid receptor (CB2) has been found in peripheral tissues, the possible presence of CB2 receptors on mast cells and their interaction with N-acylamides was investigated. Here we report that mast cells express both the gene and a functional CB2 receptor protein with negative regulatory effects on mast cell activation. Although both palmitoylethanolamide and anandamide bind to the CB2 receptor, only the former downmodulates mast cell activation in vitro. Further, the functional effect of palmitoylethanolamide, as well as that of the active cannabinoids, was efficiently antagonized by anandamide. The results suggest that (i) peripheral cannabinoid CB2 receptors control, upon agonist binding, mast cell activation and therefore inflammation; (ii) palmitoylethanolamide, unlike anandamide, behaves as an endogenous agonist for the CB2 receptor on mast cells; (iii) modulatory activities on mast cells exerted by the naturally occurring molecule strengthen a proposed autacoid local inflammation antagonism (ALIA) mechanism; and (iv) palmitoylethanolamide and its derivatives may provide antiinflammatory therapeutic strategies specifically targeted to mast cells ("ALIAmides").

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper reviews the current EU policy framework in view of its impact on hydrogen and fuel cell development. It screens EU energy policies, EU regulatory policies and EU spending policies. Key questions addressed are as follows: To what extent is the current policy framework conducive to hydrogen and fuel cell development? What barriers and inconsistencies can be identified? How can policies potentially promote hydrogen and fuel cells in Europe, taking into account the complex evolution of such a disruptive technology? How should the EU policy framework be reformed in view of a strengthened and more coherent approach? The paper concludes that the current EU policy framework does not hinder hydrogen development. Yet it does not constitute a strong push factor either. EU energy policies have the strongest impact on hydrogen and fuel cell development even though their potential is still underexploited. Regulatory policies have a weak but positive impact on hydrogen. EU spending policies show some inconsistencies. However, the large scale market development of hydrogen and fuel cells will require a new policy approach which comprises technology specific support as well as a supportive policy framework with a special regional dimension.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Primary sex determination in placental mammals is a very well studied developmental process. Here, we aim to investigate the currently established scenario and to assess its adequacy to fully recover the observed phenotypes, in the wild type and perturbed situations. Computational modelling allows clarifying network dynamics, elucidating crucial temporal constrains as well as interplay between core regulatory modules.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Hox genes encode transcription factors that regulate morphogenesis in all animals with bilateral symmetry. Although Hox genes have been extensively studied, their molecular function is not clear in vertebrates, and only a limited number of genes regulated by Hox transcription factors have been identified. Hoxa2 is required for correct development of the second branchial arch, its major domain of expression. We now show that Meox1 is genetically downstream from Hoxa2 and is a direct target. Meox1 expression is downregulated in the second arch of Hoxa2 mouse mutant embryos. In chromatin immunoprecipitation (ChIP), Hoxa2 binds to the Meox1 proximal promoter. Two highly conserved binding sites contained in this sequence are required for Hoxa2-dependent activation of the Meox1 promoter. Remarkably, in the absence of Meox1 and its close homolog Meox2, the second branchial arch develops abnormally and two of the three skeletal elements patterned by Hoxa2 are malformed. Finally, we show that Meox1 can specifically bind the DNA sequences recognized by Hoxa2 on its functional target genes. These results provide new insight into the Hoxa2 regulatory network that controls branchial arch identity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human pyruvate dehydrogenase complex (PDC) catalyzes a key step in the generation of cellular energy and is composed by three catalytic elements (E1, E2, E3), one structural subunit (E3-binding protein), and specific regulatory elements, phosphatases and kinases (PDKs, PDPs). The E1α subunit exists as two isoforms encoded by different genes: PDHA1 located on Xp22.1 and expressed in somatic tissues, and the intronless PDHA2 located on chromosome 4 and only detected in human spermatocytes and spermatids. We report on a young adult female patient who has PDC deficiency associated with a compound heterozygosity in PDHX encoding the E3-binding protein. Additionally, in the patient and in all members of her immediate family, a full-length testis-specific PDHA2 mRNA and a 5′UTR-truncated PDHA1 mRNA were detected in circulating lymphocytes and cultured fibroblasts, being bothmRNAs translated into full-length PDHA2 and PDHA1 proteins, resulting in the co-existence of both PDHA isoforms in somatic cells.Moreover, we observed that DNA hypomethylation of a CpG island in the coding region of PDHA2 gene is associatedwith the somatic activation of this gene transcription in these individuals. This study represents the first natural model of the de-repression of the testis-specific PDHA2 gene in human somatic cells, and raises some questions related to the somatic activation of this gene as a potential therapeutic approach for most forms of PDC deficiency.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

STUDY HYPOTHESIS Using optimized conditions, primary trophoblast cells isolated from human term placenta can develop a confluent monolayer in vitro, which morphologically and functionally resembles the microvilli structure found in vivo. STUDY FINDING We report the successful establishment of a confluent human primary trophoblast monolayer using pre-coated polycarbonate inserts, where the integrity and functionality was validated by cell morphology, biophysical features, cellular marker expression and secretion, and asymmetric glucose transport. WHAT IS KNOWN ALREADY Human trophoblast cells form the initial barrier between maternal and fetal blood to regulate materno-fetal exchange processes. Although the method for isolating pure human cytotrophoblast cells was developed almost 30 years ago, a functional in vitro model with primary trophoblasts forming a confluent monolayer is still lacking. STUDY DESIGN, SAMPLES/MATERIALS, METHODS Human term cytotrophoblasts were isolated by enzymatic digestion and density gradient separation. The purity of the primary cells was evaluated by flow cytometry using the trophoblast-specific marker cytokeratin 7, and vimentin as an indicator for potentially contaminating cells. We screened different coating matrices for high cell viability to optimize the growth conditions for primary trophoblasts on polycarbonate inserts. During culture, cell confluency and polarity were monitored daily by determining transepithelial electrical resistance (TEER) and permeability properties of florescent dyes. The time course of syncytia-related gene expression and hCG secretion during syncytialization were assessed by quantitative RT-PCR and enzyme-linked immunosorbent assay, respectively. The morphology of cultured trophoblasts after 5 days was determined by light microscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Membrane makers were visualized using confocal microscopy. Additionally, glucose transport studies were performed on the polarized trophoblasts in the same system. MAIN RESULTS AND THE ROLE OF CHANCE During 5-day culture, the highly pure trophoblasts were cultured on inserts coated with reconstituted basement membrane matrix . They exhibited a confluent polarized monolayer, with a modest TEER and a size-dependent apparent permeability coefficient (Papp) to fluorescently labeled compounds (MW ∼400-70 000 Da). The syncytialization progress was characterized by gradually increasing mRNA levels of fusogen genes and elevating hCG secretion. SEM analyses confirmed a confluent trophoblast layer with numerous microvilli, and TEM revealed a monolayer with tight junctions. Immunocytochemistry on the confluent trophoblasts showed positivity for the cell-cell adhesion molecule E-cadherin, the tight junction protein 1 (ZO-1) and the membrane proteins ATP-binding cassette transporter A1 (ABCA1) and glucose transporter 1 (GLUT1). Applying this model to study the bidirectional transport of a non-metabolizable glucose derivative indicated a carrier-mediated placental glucose transport mechanism with asymmetric kinetics. LIMITATIONS, REASONS FOR CAUTION The current study is only focused on primary trophoblast cells isolated from healthy placentas delivered at term. It remains to be evaluated whether this system can be extended to pathological trophoblasts isolated from diverse gestational diseases. WIDER IMPLICATIONS OF THE FINDINGS These findings confirmed the physiological properties of the newly developed human trophoblast barrier, which can be applied to study the exchange of endobiotics and xenobiotics between the maternal and fetal compartment, as well as intracellular metabolism, paracellular contributions and regulatory mechanisms influencing the vectorial transport of molecules. LARGE-SCALE DATA Not applicable. STUDY FUNDING AND COMPETING INTERESTS This study was supported by the Swiss National Center of Competence in Research, NCCR TransCure, University of Bern, Switzerland, and the Swiss National Science Foundation (grant no. 310030_149958, C.A.). All authors declare that their participation in the study did not involve factual or potential conflicts of interests.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND Canine atopic dermatitis (CAD) is a chronic inflammatory skin disease triggered by allergic reactions involving IgE antibodies directed towards environmental allergens. We previously identified a ~1.5 Mb locus on canine chromosome 27 associated with CAD in German shepherd dogs (GSDs). Fine-mapping indicated association closest to the PKP2 gene encoding plakophilin 2. RESULTS Additional genotyping and association analyses in GSDs combined with control dogs from five breeds with low-risk for CAD revealed the top SNP 27:19,086,778 (p = 1.4 × 10(-7)) and a rare ~48 kb risk haplotype overlapping the PKP2 gene and shared only with other high-risk CAD breeds. We selected altogether nine SNPs (four top-associated in GSDs and five within the ~48 kb risk haplotype) that spanned ~280 kb forming one risk haplotype carried by 35 % of the GSD cases and 10 % of the GSD controls (OR = 5.1, p = 5.9 × 10(-5)), and another haplotype present in 85 % of the GSD cases and 98 % of the GSD controls and conferring a protective effect against CAD in GSDs (OR = 0.14, p = 0.0032). Eight of these SNPs were analyzed for transcriptional regulation using reporter assays where all tested regions exerted regulatory effects on transcription in epithelial and/or immune cell lines, and seven SNPs showed allelic differences. The DNA fragment with the top-associated SNP 27:19,086,778 displayed the highest activity in keratinocytes with 11-fold induction of transcription by the risk allele versus 8-fold by the control allele (pdifference = 0.003), and also mapped close (~3 kb) to an ENCODE skin-specific enhancer region. CONCLUSIONS Our experiments indicate that multiple CAD-associated genetic variants located in cell type-specific enhancers are involved in gene regulation in different cells and tissues. No single causative variant alone, but rather multiple variants combined in a risk haplotype likely contribute to an altered expression of the PKP2 gene, and possibly nearby genes, in immune and epithelial cells, and predispose GSDs to CAD.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Thesis (Ph.D.)--University of Washington, 2016-04

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Despite more than a 10-fold increase in T cell numbers in G-CSF-mobilized peripheral blood stem cell (PBSC) grafts, incidence and severity of acute graft-vs-host disease (GVHD) are comparable to bone marrow transplantation. As CD1d-restricted, Valpha24(+)Vbeta11(+) NKT cells have pivotal immune regulatory functions and may influence GVHD, we aimed to determine whether G-CSF has any effects on human NKT cells. In this study, we examined the frequency and absolute numbers of peripheral blood NKT cells in healthy stem cell donors (n = 8) before and following G-CSF (filgrastim) treatment. Effects of in vivo and in vitro G-CSF on NKT cell cytokine expression profiles and on responsiveness of NKT cell subpopulations to specific stimulation by alpha-galactosylceramide (alpha-GalCer) were assessed. Contrary to the effects on conventional T cells, the absolute number of peripheral blood NKT cells was unaffected by G-CSF administration. Furthermore, responsiveness of NKT cells to alpha-GalCer stimulation was significantly decreased (p < 0.05) following exposure to G-CSF in vivo. This hyporesponsiveness was predominantly due to a direct effect on NKT cells, with a lesser contribution from G-CSF-mediated changes in APC. G-CSF administration resulted in polarization of NKT cells toward a Th2, IL-4-secreting phenotype following alpha-GalCer stimulation and preferential expansion of the CD4(+) NKT cell subset. We conclude that G-CSF has previously unrecognized differential effects in vivo on NKT cells and conventional MHC-restricted T cells, and effects on NKT cells may contribute to the lower than expected incidence of GVHD following allogeneic peripheral blood stem cell transplantation.