Métodos eletroanalíticos e cromatográficos aplicados na análise de corantes usados como marcadores em combustíveis

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Desenvolvimento de métodos analíticos para a determinação de 'AS', 'CU' e 'PB' em cachaça por espectrometria de absorção atômica em forno de grafite

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Desenvolvimento de métodos quantitativos e de sistemas de screening para a determinação de glifosato

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Construção, caracterização e aplicações de eletrodos modificados por poli-l-lisina e nanoeletrodos na análise de alguns compostos farmacêuticos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Sensores sólidos para detecção de óxido nítrico baseados em cucurbit[6]uril e em siloxano-poli(oxipropileno)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Detecção eletroquímica de ácidos urônicos presentes no bagaço de cana-de-açúcar utilizando eletrodo modificado com nanopartículas de cobre em técnica de HPLC

Pós-graduação em Química - IQ

Isolamento viral e diagnóstico molecular de herpevírus canino

Pós-graduação em Medicina Veterinária - FMVZ

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Desenvolvimento de sensor baseado em eletrodo modificado com nanotubos de carbono contendo pentacianonitrosilferratos de metais para determinação de antioxidantes em microemulsão de biodiesel

Pós-graduação em Química - IQ

Desenvolvimento de biossensor baseado em extrato de açaí e sensor biomimético para detecção de hexazinona

Pós-graduação em Química - IQ

Análise de aminas aromáticas em amostras de interesse ambiental por cromatografia líquida de alta eficiência acoplada a detectores de arranjo de diodo, eletroquímico e espectrometria de massas: Thiago Mescoloto Lizier. -

Pós-graduação em Química - IQ

Bacteriophage- induced reduction in Salmonella Enteritidis counts in the crop of broiler chickens undergoing preslaughter feed withdrawal

Salmonella food poisoning is a public health problem. Feed withdrawal from broiler chickens before slaughter can favor the multiplication of Salmonella in the cecum and crop of contaminated animals and subsequently lead to contamination of carcasses in the processing plant. In the present study, a cocktail of lytic bacteriophages isolated from sewage water was orally administered to 45-d-old broiler chickens 1 h after they received an oral dose of 107 cfu/mL Salmonella enterica subspecies enterica serotype Enteritidis. Immediately after phage administration and 30 min, 1, 3, 6, and 12 h thereafter, groups of chicken were killed. Ceca and crops were analyzed for the presence of Salmonella. At 3 h posttreatment, there were 103 cfu/g and 101 cfu/g of cecal and crop suspension, respectively. At 6 h after treatment, the number of Salmonella was 103 cfu/g in the cecal suspension, but below the detection limit in the crops. our results suggest that bacteriophage therapy may be able to reduce the contamination of chicken carcasses by reducing the preslaughter load of Salmonella in the birds.

Electrochemical method for quantitative determination of trace amounts of disperse dye in wastewater

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Photochemical transformation of antibiotics by excitation of Fe(III)-complexes in aqueous medium

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Simple, Direct and Simultaneous Stripping Voltammetric Determination of Lead and Copper in Gasoline Using an In Situ Mercury Film Electrode

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)