942 resultados para Instability criterion
Resumo:
BACKGROUND: Tacrolimus ointment has been shown to be effective in treatment of atopic dermatitis. OBJECTIVES: To evaluate the efficacy and safety of 0.03% tacrolimus ointment (Protopic(R)) in pediatric patients with mild, moderate and severe atopic dermatitis. METHODS.. Open, non-comparative, multicentric study carried out in Brazil. 174 patients (ages from two to 10) with mild to severe atopic dermatitis were included. Patients were instructed to apply Protopic(R) twice a day for six weeks. Primary efficacy criterion was clinical improvement >= 90% assessed by the pbysician (Clinical Response Global Evaluation Scale). Other efficacy criteria included reduction of the Eczema Area Severity Index (EASI), decrease of the affected body surface area (%BSA) and evaluation of the itching by the patients or their guardians (visual analogical scale). Safety was evaluated by adverse events reported by patients and/or guardians or by investigators. RESULTS: Thirty-three percent of patients showed clinical improvement 90%. 45.5% of patients (1st week) decreased EASI and 61.8% (6th week) (p<0,001). %BSA decreased 30.4% and 55.5% in the first and sixth week. improvement was also significant when measured by itching (p<0, 001). Most frequent adverse effects were: burning and itching. CONCLUSION: 0.03% tacrolimus ointment is a safe and effective therapy for mild to severe atopic dermatitis in pediatric patients.
Resumo:
PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.
Resumo:
Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.
Resumo:
Recently, stress myocardial computed tomographic perfusion (CTP) was shown to detect myocardial ischemia. Our main objective was to evaluate the feasibility of dipyridamole stress CTP and compare it to single-photon emission computed tomography (SPECT) to detect significant coronary stenosis using invasive conventional coronary angiography (CCA; stenosis >70%) as the reference method. Thirty-six patients (62 +/- 8 years old, 20 men) with previous positive results with SPECT (<2 months) as the primary inclusion criterion and suspected coronary artery disease underwent a customized multidetector-row CT protocol with myocardial perfusion evaluation at rest and during stress and coronary CT angiography (CTA). Multidetector-row computed tomography was performed in a 64-slice scanner with dipyridamole stress perfusion acquisition before a second perfusion/CT angiographic acquisition at rest. Independent blinded observers performed analysis of images from CTP, CTA, and CCA. All 36 patients completed the CT protocol with no adverse events (mean radiation dose 14.7 +/- 3.0 mSv) and with interpretable scans. CTP results were positive in 27 of 36 patients (75%). From the 9 (25%) disagreements, 6 patients had normal coronary arteries and 2 had no significant stenosis (8 false-positive results with SPECT, 22%). The remaining patient had an occluded artery with collateral flow confirmed by conventional coronary angiogram. Good agreement was demonstrated between CTP and SPECT on a per-patient analysis (kappa 0.53). In 26 patients using CCA as reference, sensitivity, specificity, and positive and negative predictive values were 88.0%, 79.3%, 66.7%, and 93.3% for CTP and 68.8, 76.1%, 66.7%, and 77.8%, for SPECT, respectively (p = NS). In conclusion, dipyridamole CT myocardial perfusion at rest and during stress is feasible and results are similar to single-photon emission CT scintigraphy. The anatomical-perfusion information provided by this combined CT protocol may allow identification of false-positive results by SPECT. (C) 2010 Elsevier Inc. All rights reserved. (Am J Cardiol 2010;106:310-315)
Resumo:
Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.
Resumo:
Introduction: The relevance of prostate size in the pathophysiology of lower urinary tract symptoms (LUTS) is controversial. We evaluated the urodynamic findings in patients with LUTS and small prostate volumes. Materials and Methods: 84 patients aged >= 50 years with LUTS and prostates < 40 ml were evaluated. All had an International Prostate Symptom Score (IPSS) >= 8. Average age was 62.0 +/- 8.1 years. We evaluated the impact of bladder outlet obstruction (BOO) and detrusor overactivity (DO) on the voiding symptoms and urodynamic findings. Results: Mean prostate volume was 29.2 +/- 7.2 ml and mean IPSS was 13.5 +/- 4.6. BOO was the main finding, affecting 42 (50.0%) patients, followed by detrusor underactivity (DU) in 41 (48.8%) and DO in 28 (33.3%) patients. Patients without BOO were significantly older than the obstructed (64.0 +/- 8.8 and 60.1 +/- 6.9 years, respectively; p = 0.026) and had an increased prevalence of DU (76.2 and 21.4%, respectively; p < 0.001). Comparison of patients with and without DO showed reduced bladder capacity and compliance in the DO group (p < 0.001). No other comparisons were significant. Conclusion: Half of the patients with LUTS and small prostates are not obstructed and may have DO or decreased detrusor contractility as the basis for their voiding symptoms. Our results emphasize the value of urodynamics in this population, especially when invasive treatments are being considered. Copyright (c) 2008 S. Karger AG, Basel.
Resumo:
Aims: To report the conclusion of the Think Thank 8 on Compliance Discussions during the second ICI-RS meeting in 2010. Methods: During a 3-day meeting a group of specialists discussed bladder compliance, what it represents, how it can be measured and if it is clinically relevant. Results: Bladder compliance is the result of a mathematical calculation of the volume required for a unit rise of pressure measured during a cystometric filling. It gives an indication on how the different mechanisms in the bladder wall react on stretching. There is a need of standardization of measurement and suggestions for this are given in the text. Pitfalls are described and how to avoid them. There is a wide range of compliance values in healthy volunteers and groups of patients. Poor compliance needs to be defined better as it can have significant clinical consequences. Prevention and treatment are discussed. Conclusion: If compliance is correctly measured and interpreted, it has importance in urodynamic testing and gives information relevant for clinical management. Neurourol. Urodynam. 30:714-722, 2011. (C) 2011 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The objective of this study is to determine if digital vasculitis (DV), a clinical manifestation with a high systemic lupus erythematosus disease activity index (SLEDAI) score, is associated with lupus severity. DV and other clinical manifestations defined according to the SLEDAI were evaluated in 168 consecutive patients with systemic lupus erythematosus (SLE). Two groups were defined according to presence (DV+, n = 27) or absence of DV (DV-, n = 141) at the time of evaluation. The exclusion criterion was the presence of antiphospholipid syndrome (Sapporo`s criteria). The two groups were comparable with regard to age (P = 0.09), gender (P = 1.00), white race (P = 0.81), and disease duration (P = 0.78). Compared to the DV-group, the DV+ group had a significantly higher frequency of mucocutaneous manifestations (66.7 vs. 39.0%, P = 0.01), haematological abnormalities (22.2 vs. 6.4%, P = 0.02) and constitutional symptoms (11.1 vs. 0.7%, P = 0.01). Renal and neurological involvements were similar in both groups ( P = 0.57 and P = 1.00, respectively). The evaluation of each SLEDAI parameter confirmed that the DV+ group had higher frequencies of mild manifestations, such as new rash (P = 0.02), alopecia (P = 0.02), oral ulcers (P = 0.045), fever (P = 0.01) and leucopenia (P = 0.005). In contrast, both groups had similarly increased anti-dsDNA (P = 0.78) and decreased complement levels (P = 0.29). In conclusion, DV in patients with SLE identifies a subgroup of a mild disease. The high `weighted` index attributed to this alteration in the SLEDAI score should therefore be revised. Lupus (2009) 18, 990-993.
Resumo:
Magneto-transport measurements of the 2D hole system (2DHS) in p-type Si-Si1-xGex heterostructures identify the integer quantum Hall effect (IQHE) at dominantly odd-integer filling factors v and two low-temperature insulating phases (IPs) at v = 1.5 and v less than or similar to 0.5, with re-entrance to the quantum Hall effect at v = 1. The temperature dependence, current-voltage characteristics, and tilted field and illumination responses of the IP at v = 1.5 indicate that the important physics is associated with an energy degeneracy of adjacent Landau levels of opposite spin, which provides a basis for consideration of an intrinsic, many-body origin.
Resumo:
The classification rules of linear discriminant analysis are defined by the true mean vectors and the common covariance matrix of the populations from which the data come. Because these true parameters are generally unknown, they are commonly estimated by the sample mean vector and covariance matrix of the data in a training sample randomly drawn from each population. However, these sample statistics are notoriously susceptible to contamination by outliers, a problem compounded by the fact that the outliers may be invisible to conventional diagnostics. High-breakdown estimation is a procedure designed to remove this cause for concern by producing estimates that are immune to serious distortion by a minority of outliers, regardless of their severity. In this article we motivate and develop a high-breakdown criterion for linear discriminant analysis and give an algorithm for its implementation. The procedure is intended to supplement rather than replace the usual sample-moment methodology of discriminant analysis either by providing indications that the dataset is not seriously affected by outliers (supporting the usual analysis) or by identifying apparently aberrant points and giving resistant estimators that are not affected by them.
Resumo:
We investigated the impact of obesity on the abnormalities of systolic and diastolic regional left ventricular (LV) function in patients with or without hypertension or hypertrophy, and without heart failure. We studied 120 individuals divided into 6 groups of 20 patients (42 +/- 6 years, 60 females) using standard and pulsed-wave tissue Doppler imaging (TDI) echocardiography, and heterogeneity index (HI): nonobese (I: no hypertension, no hypertrophy, control group; II: hypertension, no hypertrophy; III: hypertension and hypertrophy) and obese (IV: no hypertension, no hypertrophy; V: hypertension, no hypertrophy; VI: hypertension and hypertrophy). The criterion for obesity was BMI >= 30 kg/m(2), for hypertension was blood pressure >= 140/90 mm Hg, for hypertrophy in nonobese was LV mass/body surface area (BSA) >134 g/m(2) (men) and >110 mg/m(2) (women), and in obese was LV mass/height((2.7)) >50 (men) and >40 (women). Obese groups had normal LV ejection fraction compared with nonobese groups, but decreased longitudinal and radial systolic myocardial peak velocities (S`), and early diastolic myocardial peak velocity (E`). Also, a great variability of E` and late diastolic myocardial peak velocity (A`) from the longitudinal basal region was observed in obese groups (E` basal nonobese: 11 +/- 7 vs. obese 19 +/- 11, P < 0.001, A` basal nonobese: 7 +/- 4 vs. obese 11 +/- 7, P < 0.001). Our findings were more evident when comparing groups IV with V and VI, with the latter having concentric hypertrophy and obvious segmental systolic and diastolic dysfunctions. Subclinical myocardial alterations and increased variability of the velocities were observed in obese groups, especially with hypertension and hypertrophy, reflecting impaired regional LV relaxation, segmental atrial, and systolic dysfunctions.
Resumo:
Background: Insulin resistance and obesity are recognized as left ventricular (LV) mass determinants independent of blood pressure (BP). Prevalence of LV hypertrophy (LVH) and the relationship between LV mass to body composition and metabolic variables were evaluated in normotensive individuals as participants of a population-based study. Methods: LV mass was measured using the second harmonic image by M-mode 2D guided echocardiography in 326 normotensive subjects (mean 47 +/- 9.4 years). Fasting serum lipids and glucose, BP, body composition and waist circumference (WC) were recorded during a clinic visit. Results: Applying a normalization criterion not related to body weight (g/height raised to the power 2.7) and the cut-off points of 47.7 (men) and 46.6 g/m(2.7) (women), LVH was found in 7.9% of the sample. Univariate analysis showed LV mass (g/m(2.7)) related to age, body mass index (BMI), WC, fat and lean body mass, systolic and diastolic BP, and metabolic variables (cholesterol, HDL-c, triglycerides and glucose). In multivariate analysis only BMI and age-adjusted systolic BP remained as independent predictors of LV mass, explaining 31% and 5% of its variability. Removing BMI from the model, WC, age-adjusted systolic BP and lean mass remained independent predictors, explaining 25.0%, 4.0% and 1.5% of LV mass variability, respectively. After sex stratification, LV mass predictors were WC (8%) and systolic BP (5%) in men and WC (36%) and systolic BP (3%) in women. Conclusion: BMI in general and particularly increased abdominal adiposity (WC as surrogate) seems to account for most of LV mass increase in normotensive individuals, mainly in women. (C) 2008 Elsevier Ireland Ltd. All rights reserved.
Resumo:
A traveling wave of BaSO4 in the chlorite-thiourea reaction has shown concentric precipitation patterns upon being triggered by the autocatalyst HOCl. The precipitation patterns show circular rings of alternate null and full precipitation regions. This self-organization appears to be the result of the formation of a convective torus. The formation of the convective torus can be described as a Benard-Marangoni instability with lateral heating.
Resumo:
DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.