923 resultados para Classical F-test in two-way ANOVA


Relevância:

100.00% 100.00%

Publicador:

Resumo:

STUDY DESIGN: A cross-sectional survey was performed. OBJECTIVE: To estimate the extent of low back pain as a public health problem. SUMMARY OF BACKGROUND DATA: Health surveys converge on very high estimates of low back pain in general populations, but few studies have included severity criteria in their definition and conclusions. Because it is unlikely that interventions will influence the prevalence of minimal and infrequent symptoms, greater attention should be paid to characteristics of low back pain that indicate some impact on the life of survey respondents. METHODS: Two regions participated in the MONICA (MONitoring of trends and determinants in CArdiovascular disease) project in Switzerland. Participants randomly selected from the general population completed a standard self-administered questionnaire on cardiovascular risk factors. A special section on low back pain was added in the third (1992-1993) MONICA survey and completed by 3227 participants. RESULTS: A regional difference found in the 12-month prevalence rate disappeared with the inclusion of severity criteria. Low back pain over more than seven cumulated days was reported among men by 20.2% (age range, 25-34 years) to 28.5% (age range, 65-74 years), respectively, among women by 31.1% to 38.5%. Similar rates of reduction in activity (professional, housekeeping, and leisure time) and medical consultation (conventional and nonconventional) motivated by low back pain characterized the two participating regions. The cumulative duration of pain was related to all the indicators showing the impact of low back pain on everyday life. CONCLUSIONS: Determining the cumulative duration of low back pain over the preceding year is a straightforward task, and a cutoff at 1 week seems appropriate for distinguishing between low- and high-impact low back pain.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We prove a characterization of the support of the law of the solution for a stochastic wave equation with two-dimensional space variable, driven by a noise white in time and correlated in space. The result is a consequence of an approximation theorem, in the convergence of probability, for equations obtained by smoothing the random noise. For some particular classes of coefficients, approximation in the Lp-norm for p¿1 is also proved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An oat bioassay was conducted in pots under greenhouse conditions to determine the persistence of atrazine, metribuzin and simazine herbicides in soils of the southeast of Buenos Aires Province, Argentina. Atrazine rates of 0, 0.58, 1.16 and 2.32 mug g-1 of active ingredient (a.i.), metribuzin rates of 0, 0.14, 0.28 and 0.56 mug g-1 of a.i., and simazine rates of 0, 0.72, 1.45 and 2.9 mug g-1 of a.i. dry soil weight were applied to pots containing soils from Balcarce and San Cayetano sites. Organic matter (OM) content and pH of Balcarce soil were 5.5% and 5.8%, while for San Cayetano soil were 2.9% and 6.7%, respectively. Relative dry weight (RDW) of oat shoots was calculated as percentage of control. Considering a 20% RDW reduction of oat shoots, persistences of recommended rates for the region were: atrazine (1.16 mug g-1 of a.i.), 78 and 130 days after treatment (DAT) for Balcarce and San Cayetano soil, respectively; metribuzin (0.28 mug-1 of a.i.), 63 and 77 DAT for Balcarce and San Cayetano soil, respectively; simazine (1.45 mug g-1 of a.i.), 81 and 156 DAT for Balcarce and San Cayetano soil, respectively. Results show that persistence of atrazine, metribuzin and simazine in soil increased with high rates, low OM content and high pH.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study tested for the measurement equivalence of a four-factor measure of career indecision (Career Indecision Profile-65 [CIP-65]) between a U.S. sample and two international samples; one composed of French-speaking young adults from France and Switzerland and the other of Italian ado- lescents. Previous research had supported the four-factor structure of the CIP-65 in both the United States and Iceland but also showed that items on two of the four scales may be interpreted differently by young adults growing up in these two countries. This study extends previous research by testing whether the four CIP-65 factors are measured equivalently in two additional international samples. Results largely supported the configural and metric invariance of the CIP-65 in the United States and international samples, but several scales showed a lack of scalar invariance. Some explanations are offered for these findings along with suggestions for future research and implications for practice.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In order to identify useful parameters for maize genetic breeding programs aiming at a more efficient use of N, two maize varieties of contrasting N efficiency, Sol da Manhã NF (efficient) and Catetão (inefficient) were compared. Experiments were carried out under field and greenhouse conditions, at low and high N levels. The parameters analysed included total and relative plant and grain N content, biomass and the activities of nitrate reductase and glutamine synthetase in different parts of the plant. It was found that the translocation efficiency of N and photoassimilates to the developing seeds and the source-sink relations were significantly different for the two varieties. N content of the whole plant and grain, cob weight and the relative ear dry weight were useful parameters for characterizing the variety Sol da Manhã NF as to its efficient use of N. Enzymes activity of glutamine synthetase (transferase reaction) and nitrate reductase did not differ among the varieties.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

During the 1980-81 fiscal year, the Office of Transportation Research conducted a study to examine the existing locations of highway maintenance garages in a study area provided by the Office of Maintenance. The study successfully identified a model referred to as an "Optimum Allocation Model" for examining highway maintenance garage locations in a given area. This model can optimally assign highway segments to maintenance garages and can also be used to evaluate the financial impact of closing or relocating a highway maintenance garage utilizing the highway maintenance-related data currently available at the Iowa DOT. The present study employs the optimum allocation model to examine the existing highway maintenance garage locations in two selected areas in the southeastern and southwestern parts of the state. These areas were selected by the Office of Maintenance and are referred to as "Study Area No. 1" and "Study Area No. 2" in this study. These study areas are shown in Appendices 1 and 2, respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The purpose of this study was to assess the outcomes of 118 patients with eosinophilic granulomatosis with polyangiitis (EGPA) enrolled in 2 prospective, randomized, open-label clinical trials (1994-2005), with or without Five-Factor Score (FFS)-defined poor-prognosis factors, focusing on survival, disease-free survival, relapses, clinical and laboratory findings, therapeutic responses, and factors predictive of relapse. Forty-four patients with FFS ≥ 1 were assigned to receive 6 or 12 cyclophosphamide pulses plus corticosteroids and the seventy-four with FFS = 0 received corticosteroids alone, with immunosuppressant adjunction when corticosteroids failed. Patients were followed (2005-2011) under routine clinical care in an extended study and data were recorded prospectively. Mean ± SD follow-up was 81.3 ± 39.6 months. Among the 118 patients studied, 29% achieved long-term remission and 10% died. Among the 115 patients achieving a first remission, 41% experienced ≥1 relapses, 26.1 ± 26.8 months after treatment onset, with 57% of relapses occurring when corticosteroid-tapering reached <10 mg/day. Treatment achieved new remissions in >90%, but relapses recurred in 38%. Overall survival was good, reaching 90% at 7 years, regardless of baseline severity. Age ≥65 years was the only factor associated with a higher risk of death during follow-up. The risk of relapse was higher for patients with anti-myeloperoxidase antibodies and lower for those with >3000 eosinophils/mm(3). Sequelae remained frequent, usually chronic asthma and peripheral neuropathy. In conclusion, EGPA patients' survival rate is very good when treatment is stratified according to the baseline FFS. Relapses are frequent, especially in patients with anti-myeloperoxidase antibodies and baseline eosinophilia <3000/mm(3).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Résumé de l'article : L'hyperplasie intimale est un processus de remodelage vasculaire ubiquitaire après une lésion, pouvant menacer la perméabilité de tout type de reconstruction vasculaire. Les mécanismes physiopathologiques impliqués dans le développement de l'hyperplasie intimale ne sont que partiellement élucidés. Il est par conséquent nécessaire d'effectuer des recherches complémentaires afin d'en améliorer la compréhension et ainsi permettre l'élaboration de nouvelles stratégies thérapeutiques médicamenteuses. La culture de veines en milieu statique permet le développement de l'hyperplasie intimale. Ce modèle maintient la viabilité tissulaire, comme décrit précédemment dans d'autres études, mais empêche l'analyse des paramètres hémodynamiques. La mise au point d'un modèle de perfusion in vitro permettant la perfusion de segments vasculaires représente une approche expérimentale intégrant les différents facteurs hémodynamiques. Le système de perfusion (Ex Vivo Vein Support System) que nous avons élaboré conserve l'intégrité pariétale ainsi que les propriétés vasomotrices des veines pour une durée de 14 jours. Cette étude démontre que les deux modèles permettent le développement de l'hyperplasie intimale. Toutefois, les propriétés vasomotrices ainsi que l'influence des paramètres hémodynamiques ne peuvent être analysées que par l'utilisation du système de perfusion. Ce dernier a permis de perfuser des vaisseaux humains sans contamination bactérienne tout en maintenant l'intégrité cellulaire. Ce modèle de perfusion se rapproche plus des conditions hémodynamiques rencontrées in vivo que le modèle statique. Abstract : Background. Intimal hyperplasia (IH) is a vascular remodeling process which often leads to failure of arterial bypass or hemodialysis access. Experimental and clinical work have provided insight in IH development; however, further studies under precise con-trolled conditions are required to improve therapeutic strategies to inhibit IH development. Ex vivo perfusion of human vessel segments under standardized hemodynamic conditions may provide an adequate experimental approach for this purpose. Therefore, chronically perfused venous segments were studied and compared to traditional static culture procedures with regard to functional and histomorphologic characteristics as well as gene expression. Materials and methods. Static vein culture allowing high tissue viability was performed as previously described. Ex vivo vein support system (EVVSS) was performed using a vein support system consisting of an incubator with a perfusion chamber and a pump. EVVSS allows vessel perfusion under continuous flow while maintaining controlled hemodynamic conditions. Each human saphenous vein was divided in two parts, one cultured in a Pyrex dish and the other part perfused in EVVSS for 14 days. Testing of vasomotion, histomorphometry, expression of CD 31, Factor VIII, MIB 1, α-actin, and PAI-1 were determined before and after 14 days of either experimental conditions. Results, Human venous segments cultured under traditional or perfused conditions exhibited similar IH after 14 days as shown by histomorphometry. Smooth-muscle cell ( SMC) was preserved after chronic perfusion. Although integrity of both endothelial and smooth-muscle cells appears to be maintained in both culture conditions as confirmed by CD31, factor VIII and α-actin expression, a few smooth-muscle cells in the media stained positive for factor VIII. Cell-proliferation marker MIB-1 was also detected in the two settings and PAI-1 mRNA expression and activity increased significantly after 14 days of culture and perfusion. Conclusion. This study demonstrates the feasibility to chronically perfuse human vessels under sterile conditions with preservation of cellular integrity and vascular contractility. To gain insights into the mechanisms leading to IH, it will now be possible to study vascular remodeling not only under static conditions but also in hemodynamic environment mimicking as closely as possible the flow conditions encountered in reconstructive vascular surgery.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An effect of drift is investigated on the segregation pattern in diffusion-limited aggregation (DLA) with two components (A and B species). The sticking probability PAB (=PBA) between the different species is introduced into the DLA model with drift, where the sticking probability PAA (=PBB) between the same species equals 1. By using computer simulation it is found that the drift has an important effect on not only the morphology but also the segregation pattern. Under the drift and the small sticking probability, a characteristic pattern appears where elongated clusters of A species and of B species are periodically dispersed. The period decreases with increasing drift. The periodic structure of the deposits is characterized by an autocorrelation function. The shape of the cluster consisting of only A species (or B species) shows a vertically elongated filamentlike structure. Each cluster becomes vertically longer with decreasing sticking probability PAB. The segregation pattern is distinctly different from that with no drift and a small sticking probability PAA. The effect of the concentration on the segregation pattern is also shown.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Karyotype analysis of acute lymphoblastic leukemia (ALL) at diagnosis has provided valuable prognostic markers for treatment stratification. However, reports of cytogenetic studies of relapsed ALL samples are limited. We compared the karyotypes from 436 nonselected B-cell precursor ALL patients at initial diagnosis and of 76 patients at first relapse. We noticed a relative increase of karyotypes that did not fall into the classic ALL cytogenetic subgroups (high hyperdiploidy, t(12;21), t(9;22), 11q23, t(1;19), <45 chromosomes) in a group of 29 patients at relapse (38%) compared to 130 patients at presentation (30%). Non-classical cytogenetic aberrations in these 29 patients were mostly found on chromosomes 1, 2, 7, 9, 13, 14, and 17. We also describe six rare reciprocal translocations, three of which involved 14q32. The most frequent abnormalities were found in 9p (12/29 cases) and were associated with a marked decrease in the duration of the second remission, but not of the probability of 10-year event-free survival after relapse treatment. From 29 patients with non-classical cytogenetic aberrations, only 8 (28%) had been stratified to a high risk-arm on the first treatment protocol, suggesting that this subgroup might benefit from the identification of new prognostic markers in future studies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Landslides are an increasing problem in Nepal's Middle Hills due to both natural and human phenomena: mainly increasingly intense monsoon rains and a boom in rural road construction. This problem has largely been neglected due to underreporting of losses and the dispersed nature of landslides. Understanding how populations cope with landslides is a first step toward developing more effective landslide risk management programs. The present research focuses on two villages in Central-Eastern Nepal, both affected by active landslides but with different coping strategies. Research methods are interdisciplinary, based on a geological assessment of landslide risk and a socio-economic study of the villages using household questionnaires, focus group discussions and transect walks. Community risk maps are compared with geological landslide risk maps to better understand and communicate community risk perceptions, priorities and coping strategies. A modified typology of coping strategies is presented, based on previous work by Burton, Kates, and White (1993) that is useful for decision-makers for designing more effective programs for landslide mitigation. Main findings underscore that coping strategies, mainly seeking external assistance and outmigration, are closely linked to access to resources, ethnicity/social status and levels of community organization. Conclusions include the importance of investing in organizational skills, while building on local knowledge about landslide mitigation for reducing landslide risk. There is great potential to increase coping strategies by incorporating skills training on landslide mitigation in existing agricultural outreach and community forest user group training.