Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Neural regulation of the stress response: glucocorticoid feedback mechanisms

The mammalian stress response is an integrated physiological and psychological reaction to real or perceived adversity. Glucocorticoids are an important component of this response, acting to redistribute energy resources to both optimize survival in the face of challenge and to restore homeostasis after the immediate challenge has subsided. Release of glucocorticoids is mediated by the hypothalamo-pituitary-adrenal (HPA) axis, driven by a neural signal originating in the paraventricular nucleus (PVN). Stress levels of glucocorticoids bind to glucocorticoid receptors in multiple body compartments, including the brain, and consequently have wide-reaching actions. For this reason, glucocorticoids serve a vital function in negative feedback inhibition of their own secretion. Negative feedback inhibition is mediated by a diverse collection of mechanisms, including fast, non-genomic feedback at the level of the PVN, stress-shut-off at the level of the limbic system, and attenuation of ascending excitatory input through destabilization of mRNAs encoding neuropeptide drivers of the HPA axis. In addition, there is evidence that glucocorticoids participate in stress activation via feed-forward mechanisms at the level of the amygdala. Feedback deficits are associated with numerous disease states, underscoring the necessity for adequate control of glucocorticoid homeostasis. Thus, rather than having a single, defined feedback ‘switch’, control of the stress response requires a wide-reaching feedback ‘network’ that coordinates HPA activity to suit the overall needs of multiple body systems.

Hemodynamic mechanisms of the attenuated blood pressure response to mental stress after a single bout of maximal dynamic exercise in healthy subjects

To determine the hemodynamic mechanisms responsible for the attenuated blood pressure response to mental stress after exercise, 26 healthy sedentary individuals (age 29 ± 8 years) underwent the Stroop color-word test before and 60 min after a bout of maximal dynamic exercise on a treadmill. A subgroup (N = 11) underwent a time-control experiment without exercise. Blood pressure was continuously and noninvasively recorded by infrared finger photoplethysmography. Stroke volume was derived from pressure signals, and cardiac output and peripheral vascular resistance were calculated. Perceived mental stress scores were comparable between mental stress tests both in the exercise (P = 0.96) and control (P = 0.24) experiments. After exercise, the blood pressure response to mental stress was attenuated (pre: 10 ± 13 vs post: 6 ± 7 mmHg; P < 0.01) along with lower values of systolic blood pressure (pre: 129 ± 3 vs post: 125 ± 3 mmHg; P < 0.05), stroke volume (pre: 89.4 ± 3.5 vs post: 76.8 ± 3.8 mL; P < 0.05), and cardiac output (pre: 7.00 ± 0.30 vs post: 6.51 ± 0.36 L/min; P < 0.05). Except for heart rate, the hemodynamic responses and the mean values during the two mental stress tests in the control experiment were similar (P > 0.05). In conclusion, a single bout of maximal dynamic exercise attenuates the blood pressure response to mental stress in healthy subjects, along with lower stroke volume and cardiac output, denoting an acute modulatory action of exercise on the central hemodynamic response to mental stress.

Interleukin-10-dependent down-regulation of interferon-gamma response to Leishmania by Mycobacterium leprae antigens during the clinical course of a coinfection

We have described a case of a patient with an intriguing association of mucocutaneous leishmaniasis with lepromatous leprosy, two opposite polar forms of these spectral diseases. In the present follow-up study, we investigated the effect of the addition of Mycobacterium leprae antigens on interferon-gamma (IFN-γ) production in Leishmania antigen-stimulated cultures of peripheral blood mononuclear cells (PBMC) from this patient. For this purpose, PBMC cultures were stimulated with crude L. braziliensis and/or M. leprae whole-cell antigen extracts or with concanavalin A. In some experiments, neutralizing anti-human interleukin (IL)-10 antibodies were added to the cultures. IFN-γ and IL-10 levels in culture supernatants were measured by ELISA. During active leprosy, M. leprae antigens induced 72.3% suppression of the IFN-γ response to L. braziliensis antigen, and this suppression was abolished by IL-10 neutralization. Interestingly, the suppressive effect of M. leprae antigen was lost after the cure of leprosy and the disappearance of this effect was accompanied by exacerbation of mucosal leishmaniasis. Considered together, these results provide evidence that the concomitant lepromatous leprosy induced an IL-10-mediated regulatory response that controlled the immunopathology of mucosal leishmaniasis, demonstrating that, in the context of this coinfection, the specific immune response to one pathogen can influence the immune response to the other pathogen and the clinical course of the disease caused by it. Our findings may contribute to a better understanding of the Leishmania/M. leprae coinfection and of the immunopathogenesis of mucosal leishmaniasis.

Impairment of the hematological response and interleukin-1β production in protein-energy malnourished mice after endotoxemia with lipopolysaccharide

The objectives of this study were to determine if protein-energy malnutrition (PEM) could affect the hematologic response to lipopolysaccharide (LPS), the interleukin-1β (IL-1β) production, leukocyte migration, and blood leukocyte expression of CD11a/CD18. Two-month-old male Swiss mice were submitted to PEM (N = 30) with a low-protein diet (14 days) containing 4% protein, compared to 20% protein in the control group (N = 30). The total cellularity of blood, bone marrow, spleen, and bronchoalveolar lavage evaluated after the LPS stimulus indicated reduced number of total cells in all compartments studied and different kinetics of migration in malnourished animals. The in vitro migration assay showed reduced capacity of migration after the LPS stimulus in malnourished animals (45.7 ± 17.2 x 10(4) cells/mL) compared to control (69.6 ± 7.1 x 10(4) cells/mL, P ≤ 0.05), but there was no difference in CD11a/CD18 expression on the surface of blood leukocytes. In addition, the production of IL-1β in vivo after the LPS stimulus (180.7 pg·h-1·mL-1), and in vitro by bone marrow and spleen cells (41.6 ± 15.0 and 8.3 ± 4.0 pg/mL) was significantly lower in malnourished animals compared to control (591.1 pg·h-1·mL-1, 67.0 ± 23.0 and 17.5 ± 8.0 pg/mL, respectively, P ≤ 0.05). The reduced expression of IL-1β, together with the lower number of leukocytes in the central and peripheral compartments, different leukocyte kinetics, and reduced leukocyte migration capacity are factors that interfere with the capacity to mount an adequate immune response, being partly responsible for the immunodeficiency observed in PEM.

Effect of the ketamine/xylazine anesthetic on the auditory brainstem response of adult gerbils

The auditory brainstem response (ABR) is a test widely used to assess the integrity of the brain stem. Although it is considered to be an auditory-evoked potential that is influenced by the physical characteristics of the stimulus, such as rate, polarity and type of stimulus, it may also be influenced by the change in several parameters. The use of anesthetics may adversely influence the value of the ABR wave latency. One of the anesthetics used for e ABR assessment, especially in animal research, is the ketamine/xylazine combination. Our objective was to determine the influence of the ketamine/xylazine anesthetic on the ABR latency values in adult gerbils. The ABRs of 12 adult gerbils injected with the anesthetic were collected on three consecutive days, or a total of six collections, namely: pre-collection and A, B, C, D, and E collections. Before each collection the gerbil was injected with a dose of ketamine (100 mg/kg)/xylazine (4 mg/kg). For the capture of the ABR, 2000 click stimuli were used with rarefaction polarity and 13 stimuli per second, 80 dBnHL intensity and in-ear phones. A statistically significant difference was observed in the latency of the V wave in the ABR of gerbils in the C and D collections compared to the pre-, A and E collections, and no difference was observed between the pre-, A, B, and E collections. We conclude that the use of ketamine/xylazine increases the latency of the V wave of the ABR after several doses injected into adult gerbils; thus clinicians should consider the use of this substance in the assessment of ABR.

Whole-body vibration decreases the proliferativeb response of TCD4+ cells in elderly individuals with knee osteoarthritis

The aim of this study was to investigate the effect of adding whole-body vibration (WBV; frequency = 35 to 40 Hz; amplitude = 4 mm) to squat training on the T-cell proliferative response of elderly patients with osteoarthritis (OA) of the knee. This study was a randomized controlled trial in which the selected variables were assessed before and after 12 weeks of training. Twenty-six subjects (72 ± 5 years of age) were divided into three groups: 1) squat training with WBV (WBV, N = 8); 2) squat training without WBV (N = 10), and 3) a control group (N = 8). Women who were ≥60 years of age and had been diagnosed with OA in at least one knee were eligible. The intervention consisted of 12 uninterrupted weeks of squatting exercise training performed 3 times/week. Peripheral blood mononuclear cells were obtained from peripheral blood collected before and after training. The proliferation of TCD4+ and TCD8+ cells was evaluated by flow cytometry measuring the carboxyfluorescein succinimidyl ester fluorescence decay before and after the intervention (∆). The proliferative response of TCD4+ cells (P = 0.02, effect size = 1.0) showed a significant decrease (23%) in the WBV group compared to the control group, while there was no difference between groups regarding the proliferative response of TCD8+ cells (P = 0.12, effect size = 2.23). The data suggest that the addition of WBV to squat exercise training might modulate T-cell-mediated immunity, minimizing or slowing disease progression in elderly patients with OA of the knee.

Short-term and long-term antibody response by mice after immunization against Neisseria meningitidis B or diphtheria toxoid

Serogroup B Neisseria meningitidis (MenB) is a major cause of invasive disease in early childhood worldwide. The only MenB vaccine available in Brazil was produced in Cuba and has shown unsatisfactory efficacy when used to immunize millions of children in Brazil. In the present study, we compared the specific functional antibody responses evoked by the Cuban MenB vaccine with a standard vaccine against diphtheria (DTP: diphtheria, tetanus, pertussis) after primary immunization and boosting of mice. The peak of bactericidal and opsonic antibody titers to MenB and of neutralizing antibodies to diphtheria toxoid (DT) was reached after triple immunization with the MenB vaccine or DTP vaccine, respectively. However, 4 months after immunization, protective DT antibody levels were present in all DTP-vaccinated mice but in only 20% of the mice immunized against MenB. After 6 months of primary immunization, about 70% of animals still had protective neutralizing DT antibodies, but none had significant bactericidal antibodies to MenB. The booster doses of DTP or MenB vaccines produced a significant antibody recall response, suggesting that both vaccines were able to generate and maintain memory B cells during the period studied (6 months post-triple immunization). Therefore, due to the short duration of serological memory induced by the MenB vaccine (VA-MENGOC-BC® vaccine), its use should be restricted to outbreaks of meningococcal disease.

Exaggerated blood pressure response during the exercise treadmill test as a risk factor for hypertension

Exaggerated blood pressure response (EBPR) during the exercise treadmill test (ETT) has been considered to be a risk factor for hypertension. The relationship of polymorphisms of the renin-angiotensin system gene with hypertension has not been established. Our objective was to evaluate whether EBPR during exercise is a clinical marker for hypertension. The study concerned a historical cohort of normotensive individuals. The exposed individuals were those who presented EBPR. At the end of the observation period (41.7 months = 3.5 years), the development of hypertension was analyzed within the two groups. Genetic polymorphisms and blood pressure behavior were assessed as independent variables, together with the classical risk factors for hypertension. The I/D gene polymorphism of the angiotensin-converting enzyme and M235T of angiotensinogen were ruled out as risk factors for hypertension. EBPR during ETT is not an independent influence on the chances of developing hypertension. No differences were observed between the hypertensive and normotensive individuals regarding gender (P = 0.655), skin color (P = 0.636), family history of hypertension (P = 0.225), diabetes mellitus (P = 0.285), or hypertriglyceridemia (P = 0.734). The risk of developing hypertension increased with increasing body mass index (BMI) and advancing age. The risk factors, which independently influenced the development of hypertension, were age and BMI. EBPR did not constitute an independent risk factor for hypertension and is probably a preclinical phase in the spectrum of normotension and hypertension.

Brief daily postpartum separations from the litter alter dam response to psychostimulants and to stress

Neonatal handling induces several behavioral and neurochemical alterations in pups, including decreased responses to stress and reduced fear in new environments. However, there are few reports in the literature concerning the behavioral effects of this neonatal intervention on the dams during the postpartum period. Therefore, the aim of the current study was to determine if brief postpartum separation from pups has a persistent impact on the dam's stress response and behavior. Litters were divided into two neonatal groups: 1) non-handled and 2) handled [10 min/day, from postnatal day (PND) 1 to 10]. Weaning occurred at PND 21 when behavioral tasks started to be applied to the dams, including sweet food ingestion (PND 21), forced swimming test (PND 28), and locomotor response to a psychostimulant (PND 28). On postpartum day 40, plasma was collected at baseline for leptin assays and after 1 h of restraint for corticosterone assay. Regarding sweet food consumption, behavior during the forced swimming test or plasma leptin levels did not differ between dams briefly separated and non-separated from their pups during the postpartum period. On the other hand, both increased locomotion in response to diethylpropion and increased corticosterone secretion in response to acute stress were detected in dams briefly separated from their pups during the first 10 postnatal days. Taken together, these findings suggest that brief, repeated separations from the pups during the neonatal period persistently impact the behavior and induce signs of dopaminergic sensitization in the dam.

Adenovirus-mediated siRNA targeting TNF-α and overexpression of bone morphogenetic protein-2 promotes early osteoblast differentiation on a cell model of Ti particle-induced inflammatory response in vitro

Wear particles are phagocytosed by macrophages and other inflammatory cells, resulting in cellular activation and release of proinflammatory factors, which cause periprosthetic osteolysis and subsequent aseptic loosening, the most common causes of total joint arthroplasty failure. During this pathological process, tumor necrosis factor-alpha (TNF-α) plays an important role in wear-particle-induced osteolysis. In this study, recombination adenovirus (Ad) vectors carrying both target genes [TNF-α small interfering RNA (TNF-α-siRNA) and bone morphogenetic protein 2 (BMP-2)] were synthesized and transfected into RAW264.7 macrophages and pro-osteoblastic MC3T3-E1 cells, respectively. The target gene BMP-2, expressed on pro-osteoblastic MC3T3-E1 cells and silenced by the TNF-α gene on cells, was treated with titanium (Ti) particles that were assessed by real-time PCR and Western blot. We showed that recombinant adenovirus (Ad-siTNFα-BMP-2) can induce osteoblast differentiation when treated with conditioned medium (CM) containing RAW264.7 macrophages challenged with a combination of Ti particles and Ad-siTNFα-BMP-2 (Ti-ad CM) assessed by alkaline phosphatase activity. The receptor activator of nuclear factor-κB ligand was downregulated in pro-osteoblastic MC3T3-E1 cells treated with Ti-ad CM in comparison with conditioned medium of RAW264.7 macrophages challenged with Ti particles (Ti CM). We suggest that Ad-siTNFα-BMP-2 induced osteoblast differentiation and inhibited osteoclastogenesis on a cell model of a Ti particle-induced inflammatory response, which may provide a novel approach for the treatment of periprosthetic osteolysis.

Leukocytosis, muscle damage and increased lymphocyte proliferative response after an adventure sprint race

The effect of an adventure sprint race (ASR) on T-cell proliferation, leukocyte count and muscle damage was evaluated. Seven young male runners completed an ASR in the region of Serra do Espinhaço, Brazil. The race induced a strong leukocytosis (6.22±2.04×103 cells/mm3 beforevs 14.81±3.53×103 cells/mm3after the race), marked by a significant increase of neutrophils and monocytes (P<0.05), but not total lymphocytes, CD3+CD4+ or CD3+CD8+ cells. However, the T-cell proliferative response to mitogenic stimulation was increased (P=0.025) after the race, which contradicted our hypothesis that ASR, as a high-demand competition, would inhibit T-cell proliferation. A positive correlation (P=0.03, r=0.79) was observed between the proliferative response of lymphocytes after the race and the time to complete the race, suggesting that the proliferative response was dependent on exercise intensity. Muscle damage was evident after the race by increased serum levels of aspartate amino transferase (24.99±8.30 vs 50.61±15.76 U/L, P=0.003). The results suggest that humoral factors and substances released by damaged muscle may be responsible for lymphocyte activation, which may be involved in muscle recovery and repair.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

A dose-response curve for biodosimetry from a 6 MV electron linear accelerator

Biological dosimetry (biodosimetry) is based on the investigation of radiation-induced biological effects (biomarkers), mainly dicentric chromosomes, in order to correlate them with radiation dose. To interpret the dicentric score in terms of absorbed dose, a calibration curve is needed. Each curve should be constructed with respect to basic physical parameters, such as the type of ionizing radiation characterized by low or high linear energy transfer (LET) and dose rate. This study was designed to obtain dose calibration curves by scoring of dicentric chromosomes in peripheral blood lymphocytes irradiated in vitro with a 6 MV electron linear accelerator (Mevatron M, Siemens, USA). Two software programs, CABAS (Chromosomal Aberration Calculation Software) and Dose Estimate, were used to generate the curve. The two software programs are discussed; the results obtained were compared with each other and with other published low LET radiation curves. Both software programs resulted in identical linear and quadratic terms for the curve presented here, which was in good agreement with published curves for similar radiation quality and dose rates.