Only the B biotype of Bemisia tabaci is present on vegetables in São Paulo State, Brazil

Bemisia tabaci (Genn.) é considerada uma das mais importantes pragas em cultivos de hortaliças e ornamentais em todo o mundo. Baseado na análise da seqüência mitocondrial (citocromo oxidase I - mtCOI) foi proposto recentemente que B. tabaci deva ser considerado um complexo críptico de espécies, contendo 11 grupos e 24 espécies. Dois destes grupos: Middle East-Asia Minor e Mediterranean englobam os biótipos B e Q, respectivamente. Avaliou-se a sequência mtCOI de espécimes de B. tabaci coletados em regiões do estado de São Paulo, Brasil. Por PCR-RFLP utilizando-se a enzima Taq I, pôde-se observar somente o padrão típico de clivagem para o biótipo B. Comparando-se com sequências consenso, todas as moscas brancas foram classificadas no grupo Middle East-Asia Minor e puderam ser separadas em quatro haplótipos, indicando prevalência do biótipo B em áreas de pimentão (Capsicum annuum L.), tomate (Solanum lycopersicum L.), cucurbitáceas e berinjela (Solanum melongena L.) do Estado de São Paulo.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Produção de quitosanase por aspergillus ochraceus em cultivo descontínuo submerso

In this work a 24 factorial design with triplicate at central point was used in order to investigate the influence of chitosan concentration (substrate) (Cs), culture media temperature (CMT), aeration ratio (AR) as well as agitation (A) on chitosanase production by Aspergillus ochraceus. Experiments were carried out using the following levels to the factors: (Cs) (-1) 0.1%; (0) 0.15%; (+1) 0.2%; (TMC) (-1) 25 minutes; (0) 30 minutes; (+1) 35 minutes; (RA) (-1) 0.4; (0) 0.6; (+1) 0.8; (A) (-1) 90 rpm, (0) 120 rpm, (+1) 150 rpm. One chitosanolytic activity (U.mL-1) was defined as the enzyme necessary to produce 1.0 mmol.min-1 of glicosamine by mL of extract. Chitosanolytic assays were carried out using two extract volumes, 0.05 and 0.1 mL, respectively. Results showed that was possible to produce chitosanase of order aproximatelly 5,9 U.mL-1 by Aspergillus ochraceus and chitosanolytic activity was increased by increment on substrate concentration, aeration ratio as well as agitation while media culture temperature increment decreased activity

Avaliação, identificação e atividade enzimática de bactérias psicotróficas presentes no leite cru refrigerado

Extended storage of refrigerated milk can lead to reduced quality of raw and processed milk, which is a consequence of the growth and metabolic activities of psychrotrophic bacteria, able to grow under 7oC or lower temperatures. Although most of these microorganisms are destroyed by heat treatment, some have the potential to produce termoresistant proteolytic and lipolytic enzymes that can survive even UHT processing and reduce the processed products quality. Recently, the IN 51 determineds that milk should be refrigerated and stored at the farm what increased the importance of this group of microorganisms. In this work, psychrotrophic bacteria were isolated from 20 communitarian bulk tanks and 23 individual bulk tanks from dairy farms located at Zona da Mata region of Minas Gerais State and from southeastern Rio de Janeiro. Selected milk dilutions were plated on standard agar and after incubation for 10 days at 7oC, five colonies were isolated, firstly using nutrient agar and after using McConkey agar for 24 hours at 21oC. The isolates were identified by morphology, Gram stain method, catalase production, fermentative/oxidative metabolism and by API 20E, API 20NE, API Staph, API Coryne or API 50 CH (BioMerieux). In order to ensure reproductibility, API was repeated for 50% of the isolates. Species identification was considered when APILAB indexes reached 75% or higher. 309 strains were isolated, 250 Gram negative and 59 Gram positive. 250 Gram negative isolates were identified as: Acinetobacter spp. (39), Aeromonas spp. (07), A. Hydrophila (16), A. sobria (1), A. caviae (1), Alcaligenes feacalis (1), Burkholderia cepacia (12), Chryseomonas luteola (3), Enterobacter sp. (1), Ewingella americana(6), Hafnia alvei (7), Klebsiella sp. (1), Klebsiella oxytoca (10), Yersinia spp. (2), Methylobacterium mesophilicum (1), Moraxella spp. (4), Pantoea spp. (16), Pasteurella sp. (1), Pseudomonas spp. (10), P. fluorescens (94), P. putida (3), Serratia spp. (3), Sphigomonas paucomobilis (1). Five isolates kept unidentified. Pseudomonas was the predominant bacteria found (43%) and P. fluorescens the predominant species (37.6%), in accordance with previous reports. Qualitative analysis of proteolytic and lipolytic activity was based on halo formation using caseinate agar and tributirina agar during 72 hours at 21oC and during 10 days at 4°C, 10oC and 7°C. Among 250 Gram negative bacteria found, 104 were identified as Pseudomonas spp. and 60,57% of this group showed proteolytic and lipolytic acitivities over all four studied temperatures. 20% of Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Chryseomonas, Methylobacterium, Moraxella presented only lipolytic activity. Some isolates presented enzymatic activity in one or more studied temperatures. Among Gram positive bacteria, 30.51% were proteolytic and lipolytic at 10oC, 8.47% were proteolytic at 7oC, 10oC, and 21oC, 8.47% were proteolytic at all studied temperatures (4oC, 7oC, 10oC and 21oC) and 3.38% were proteolytic only at 21oC. At 4oC, only one isolate showed proteolytic activity and six isolates were lipolytic. In relation to Gram negative microorganisms, 4% were proteolytic and lipolytic at 7oC, 10oC and 21oC, 10% were proteolytic at 10oC and 4.4% were lipolytic at 4oC, 7oC, 10oC and 21oC, while 6.4% of all isolates were proteolytic and lipolytic at 10oC and 21oC as well as lipolytic at 4oC and 7oC. These findings are in accordance with previous researches that pointed out Pseudomonas as the predominant psycrotrophic flora in stored refrigerated raw milk

Funcionalidade dos extratos fenólicos obtidos pelo cultivo semi-sólido de resíduos de abacaxi (Ananas comusus L.) e goiaba (Psidium guajava L.)

Solid substrate cultivation (SSC) has become an efficient alternative towards rational use of agro industrial wastes and production of value-added products, mainly in developing countries. This work presents the production and functional application results of phenolic extracts obtained by solid substrate cultivation of pineapple (Ananas comosus L.) and guava (Psidium guajava L.) residues associated to soy flour and bioprocessed by Rhizopus oligosporus fungus. Two experimental groups were tested: (1) 9g of fruit residue and 1g of soy flour (A9 or G9); (2) 5g of fruit residue and 5g of soy flour (A5 or G5). After SSC, 100ml of distilled water was added to each Erlenmeyer flask containing 10g of bioprocessed material in order to obtain the phenolic extracts. Samples were taken every two days for total phenolic concentration (TPC) and antioxidant capacity evaluation by DPPH test during 12-day cultivation. The 2-day and 10-d ay extracts were selected and concentrated by ebullition until 1/10 of original volume was reached. After that, both non-concentrated and concentrated extracts were evaluated for their antimicrobial activity against Staphylococcus aureus and Salmonella enterica and a-amylase inhibitory capacity. It was observed an inverse relationship between total phenolic concentration (TPC) and antioxidant capacity during the cultivation. Besides that, the concentrated pineapple samples after two days were able to inhibit both pathogens tested, especially S. aureus. Guava concentrated extracts after 2 days showed expressive inhibition against S. enterica, but negative results against S. aureus growth. When it comes to a-amylase inhibition, A9 extracts after 2 days, both concentrated or not, completely inhibited enzyme activity. Similar behavior was observed for G9 samples, but only for concentrated samples. It was shown that concentration by ebullition positively affected the enzymatic inhibition of G9 and A9 samples, but on the other side, decreased antiamylase activity of A5 and G5 samples

Hidrólise de resíduos lignocelulósicos utilizando extrato enzimático celulolítico produzido por Trichoderma reesei atcc 2768

Cellulolytic enzymatic broth by Trichoderma reesei ATCC 2768 cultived in shaker using cashew apple bagasse and coconut shell bagasse, as substrate for fermentation, was used to investigate the enzymatic hydrolysis of these substrates after pre-treatment with 1 M NaOH, wet-oxidation as well as a combination of these treatments. Hydrolysis runs were carried at 125 rpm, 50ºC and initial pH of 4.8 for 108 hours. Enzymatic broth produced using cashew apple bagasse treated with 1M NaOH (1.337 UI/mL CMCase and 0.074 UI/mL FPase), showed after the hydrolysis an initial of 0.094 g of reducing sugar/g of substrate.h with 96% yield of total reducing sugars while for the coconut shell bagasse treated using the alkaline process (0.640 UI/mL CMCase and 0.070 UI/mL FPase) exhibited an initial hydrolysis velocity of 0.025 g of reducing sugar/g of substrate.h with 48% yield of total reducing sugars. For the treatment with wet-oxidation using cashew apple bagasse as substrate enzymatic broth (0.547 UI/mL CMCase) exhibited an initial hydrolysis velocity of 0.014 g of reducing sugars/g of substrate.h with a lower yield about 89% of total reducing sugars compared to the alkaline treatment. Enzymatic broth produced using coconut shell treated by wet-oxidation showed an initial hydrolysis velocity of 0.029 g of reducing sugar/g of substrate.h with 91% yield. However, when the combination of these two treatments were used it was obtained an enzymatic broth of 1.154 UI/mL CMCase and 0.107 FPase for the cashew apple bagasse as well as 0.538 UI/mL CMCase and 0,013 UI/mL de FPase for the coconut shell bagasse. After hydrolysis, initial velocity was 0.029 g of reducing sugar/g of substrate.h. with 94% yield for the cashew apple bagasse and 0.018 g de reducing sugar/g of substrate.h with 69% yield for coconut shell bagasse. Preliminary treatment improves residues digestibility showing good yields after hydrolysis. In this case, cellulose from the residue can be converted into glucose by cellulolytic enzymes that can be used for ethanol production

Produção de enzimas extracelulares por Fusarium solani de maracujazeiro amarelo

Uma das principais doenças do maracujazeiro, na maioria dos estados produtores do Brasil, é a podridão do colo, causada por Fusarium solani. Pouco se sabe a respeito da fisiologia deste patógeno do maracujazeiro amarelo, principalmente quanto à produção de enzimas extracelulares. O objetivo do presente trabalho foi verificar, em meios de cultura individuais e apropriados, a produção das enzimas extracelulares amilase, lipase, celulase, proteases (caseinase e gelatinase), lacase (oxidase) e catalase por isolados de F. solani, provenientes de maracujazeiro amarelo. O delineamento experimental adotado foi o inteiramente casualizado, em esquema de dois fatores (nove isolados versus sete enzimas), com três repetições. Todos os isolados de F. solani produziram, de maneira semiquantitativa, as enzimas extracelulares amilase, lipase, celulase, caseinase (protease) e lacase (oxidase). No entanto, a quantidade produzida de cada enzima foi significativamente diferente entre os isolados. As enzimas extracelulares gelatinase (protease) e catalase foram produzidas em pouca quantidade e de maneira igual por todos os isolados do fungo.

Avaliação físico-química e funcional da algaroba prosopis juliflora proveniente da mesorregião agreste do Rio Grande do Norte

Algaroba (Prosopis juliflora) is a typical legume from arid and semi arid regions, which is composed by sugar-rich pods and high protein seeds. Phenolic compounds are secondary metabolites recognized as potent bioactive compounds, found in several vegetables.Therefore, the objective of this work is to characterize the algaroba flour in terms of its physicalchemical composition, total phenolic content, antioxidant activity by DPPH and ABTS methods, a-amylase and a-glycosidase inhibition, as well as to analyze its organic compounds by high performance liquid chromatography (HPLC). Three experimental groups were investigated (seeds, seeds and pod together and only pod), which were prepared by oven drying and posterior grinding. Water and ethanol extracts (70, 80, 100% v/v) were prepared and used for functional studies. Organic compounds were detected by using HPLC equipment coupled to mass spectrometer. Results show important physical-chemical differences among the experimental groups, seeds, seeds and pod together and only pod. The algarroba seed flour is high in protein (49.49%) and fat (3.10%), while the pod flour is especially rich in sugar (60.3% to 67.9%). Algaroba phenolics are concentrated in pod flour, mainly in water extracts (1.30 mg GAEQ/100g sample). All seed extracts showed high DPPH activity and maximum antioxidant activity was registered for ethanol 80% extracts (19.81 μM Trolox/g sample). The ABTS activity ranged from 9.73 to 12.74 μM Trolox/g sample. Nearly all the extracts were able to inhibit α-amylase activity mildly (30.50% to 48.80%), while the maximum α-glycosidase inhibition was observed for pod water extracts (81.03%). Algaroba water extracts proven to be especially rich in organic compounds, observed by the high number of chromatographic peaks. Results demonstrate that algaroba is a potential candidate for further investigations concerning its possible functional applications

Ocorrência e variabilidade genética do Tomato severe rugose virus em tomateiro e pimentão no Estado de São Paulo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Extração enzimática de óleo e produção in situ de biodiesel a partir da Moringa oleífera Lam

With the growth and development of modern society, arises the need to search for new raw materials and new technologies which present the "clean" characteristic, and do not harm the environment, but can join the energy needs of industry and transportation. The Moringa oleifera Lam, plant originating from India, and currently present in the Brazilian Northeast, presents itself as a multi-purpose plant, can be used as a coagulant in water treatment, as a natural remedy and as a feedstock for biodiesel production. In this work, Moringa has been used as a raw material for studies on the extraction and subsequently in the synthesis of biodiesel. Studies have been conducted on various techniques of Moringa oil extraction (solvents, mechanical pressing and enzymatic), being specially developed an experimental design for the aqueous extraction with the aid of the enzyme Neutrase© 0.8 L, with the aim of analyzing the influence variable pH (5.5-7.5), temperature (45-55°C), time (16-24 hours) and amount of catalyst (2-5%) on the extraction yield. In relation to study of the synthesis of biodiesel was initially carried out a conventional transesterification (50°C, KOH as a catalyst, methanol and 60 minutes reaction). Next, a study was conducted using the technique of in situ transesterification by using an experimental design variables as temperature (30-60°C), catalyst amount (2-5%), and molar ratio oil / ethanol (1:420-1:600). The extraction technique that achieved the highest extraction yield (35%) was the one that used hexane as a solvent. The extraction using 32% ethanol obtained by mechanical pressing and extraction reached 25% yield. For the enzymatic extraction, the experimental design indicated that the extraction yield was most affected by the effect of the combination of temperature and time. The maximum yield obtained in this extraction was 16%. After the step of obtaining the oil was accomplished the synthesis of biodiesel by the conventional method and the in situ technique. The method of conventional transesterification was obtained a content of 100% and esters by in situ technique was also obtained in 100% in the experimental point 7, with a molar ratio oil / alcohol 1:420, Temperature 60°C in 5% weight KOH with the reaction time of 1.5 h. By the experimental design, it was found that the variable that most influenced the ester content was late the percentage of catalyst. By physico-chemical analysis it was observed that the biodiesel produced by the in situ method fell within the rules of the ANP, therefore this technique feasible, because does not require the preliminary stage of oil extraction and achieves high levels of esters

Produção de enzimas por fungos em fermentação semi-sólida utilizando bagaço de coco e pedúnculo de caju como substratos

The production of enzymes by microorganisms using organic residues is important and it can be associated with several applications such as food and chemical industries and so on. The objective of this work is the production of CMCase, Xylanase, Avicelase and FPase enzymes by solid state fermentation (SSF) using as substrates: bagasse of coconut and dried cashew stem. The microorganisms employed are Penicillium chrysogenum and an isolated fungus from the coconut bark (Aspergillus fumigatus). Through the factorial design methodology and response surface analysis it was possible to study the influence of the humidity and pH. For Penicillium chrysogenum and the isolated fungus, the coconut bagasse was used as culture medium. In another fermentation, it was used the mixture of coconut bagasse and cashew stem. Fermentations were conducted using only the coconut bagasse as substrate in cultures with Penicillium chrysogenum fungus and the isolated one. A mixture with 50% of coconut and 50% of cashew stem was employed only for Penicillium chrysogenum fungus, the cultivation conditions were: 120 hours at 30 °C in BOD, changing humidity and pH values. In order to check the influence of the variables: humidity and pH, a 2 2 factorial experimental design was developed, and then two factors with two levels for each factor and three repetitions at the central point. The levels of the independent variables used in ascending order (-1, 0, +1), to humidity, 66%, 70.5% and 75% and pH 3, 5 and 7, respectively. The software STATISTICA TM (version 7.0, StatSoft, Inc.) was used to calculate the main effects of the variables and their interactions. The response surface methodology was used to optimize the conditions of the SSF. A chemical and a physic-chemical characterization of the coconut bagasse have determined the composition of cellulose (%) = 39.09; Hemicellulose (%) = 23.80, Total Lignin (%) = 36.22 and Pectin (%) = 1.64. To the characterization of cashew stem, the values were cellulose (g) = 15.91 Hemicellulose (%) = 16.77, Total Lignin (%) = 30.04 and Pectin (%) = 15.24. The results indicate the potential of the materials as substrate for semisolid fermentation enzyme production. The two microorganisms used are presented as good producers of cellulases. The results showed the potential of the fungus in the production of CMCase enzyme, with a maximum of 0.282 UI/mL and the Avicelase enzyme the maximum value ranged from 0.018 to 0.020 UI/ mL, using only coconut bagasse as substrate. The Penicillium chrysogenum fungus has showed the best results for CMCase = 0.294 UI/mL, FPase = 0.058 UI/mL, Avicelase = 0.010 UI/mL and Xylanase = 0.644 UI/ mL enzyme, using coconut bagasse and cashew stem as substrates. The Penicllium chrysogenum fungus showed enzymatic activities using only the coconut as substrate for CMCase = 0.233 UI/mL, FPase = 0.031 to 0.032 UI/ mL, Avicelase = 0.018 to 0.020 UI/mL and Xylanase = 0.735 UI/ mL. Thus, it can be concluded that the used organisms and substrates have offered potential for enzyme production processes in a semi-solid cultivation

Estudo da produção de pectinase por fermentação em estado sólido utilizando pedúnculo de caju como substrato

Pectinolytic enzymes, or simply pectinases, are complex enzymes that degrade pectic polymers. They have many uses, such as fruit juice extraction and purification, textile fiber treatment and vegetal oil extraction. The aim of this work was to study the kinetics of pectinases production by solid-state fermentation, using dry cashew apple residue as substrate and the microorganism Aspergillus niger CCT 0916. The influence of the initial medium moisture and medium supplementation with a source of nitrogen and phosphorus was evaluated using the factorial experimental planning and response surface methodology. Ammonia sulphate and potassium phosphate were used as nitrogen and phosphorus source, respectively. The variables time of contact (T) and ratio volume solvent/fermented medium (RZ), in systems with and without agitation, were evaluated in order to study the best extraction condition of the produced enzyme. Washed and unwashed cashew apple residues were tested as the growth medium. The unwashed residue was obtained by drying the residue after the extraction of the juice, while the washed residue was obtained by water washing 5 times using the proportion of 1 kg pulp/2 liters of water. Samples were taken every 12 hours for moisture content, pH, protein, reducing sugars, polygalacturonase activity (PG) and viscosity reduction. The physical-chemical composition of the residues had different sugar and pectin levels. For the unwashed residue, the peak activity was reached with 40% of initial moisture content, 1% of nitrogen supplementation without phosphorus addition after 30 hours of process. These conditions led to 16 U/g of PG activity and 82% of viscosity reduction. The calculated models reached similar values to the experimental ones in the same process conditions: 15.55 U/g of PG and 79.57% of viscosity eduction. Similarly, the greatest enzyme production for washed residue was reached with 40% initial moisture content, 1% nitrogen supplementation without phosphorus addition after 22 hours of cultivation. In this condition it was obtained polygalacturonase activity of 9.84 U/g and viscosity reduction of 81.36%. These values are close to experimental values that were of 10.1 U/g and 81%, respectively. The conditions that led to the best PG activity results was the agitated one and the best extraction condition was obtained with 100 minutes of solvent/medium contact and RZ of 5 (mL/g)

Otimização do meio de cultura para a produção de quitosanase por metarhizium anisopliae em cultivo descontínuo submerso

In this work a Plackett-Burman Design with 8 factors and 12 trials in 2 levels with 3 repetitions at the center point was used in order to investigate the influence of the concentration of chitosan, peptone, yeast extract, NaNO3, K2HPO4, KCl, MgSO4.7H2O and FeSO4 on chitosanase production by Metarhizium anisopliae. Runs were carried out using submerged discontinuous cultivation for enzyme production. The results of the Plackett & Burman Design showed that only two factors, chitosan concentration as well as FeSO4 had influence on chitosanolytic activity, while the increase in concentration of other factors not contributed significantly to the quitosanolítica activity. Cultivation medium optimization for enzyme production was carried out using a Composite Central Design, with the most important factors for chitosanolytic activity (chitosan and FeSO4), in accordance with Plackett & Burman Design, and keeping the other nutrients in their minimum values. On this other design, it was taken the highest limit in Plackett & Burman Design as the lowest limit (-1) to FeSO4 factor. The results showed that the enzyme production was favoured by increasing the chitosan concentration and by decreasing FeSO4. Maximum production for chitosanolytic activity was about 70.0 U/L and was reached in only 18 h of fermentation, a result about twenty-eight times greater than a former study using the same microorganism (about 2.5 U/L at 48 h)

Properties of a new fungal b-galactosidase with potential application in the dairy industry

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Production and action pattern of inulinase from Aspergillus Niger-245: hydrolysis of inulin from several sources

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)