ADP-Dependent Phosphorylation Regulates Association of a DNA-Binding Complex with the Barley Chloroplast psbD Blue-Light-Responsive Promoter1

The chloroplast gene psbD encodes D2, a chlorophyll-binding protein located in the photosystem II reaction center. Transcription of psbD in higher plants involves at least three promoters, one of which is regulated by blue light. The psbD blue-light-regulated promoter (BLRP) consists of a −10 promoter element and an activating complex, AGF, that binds immediately upstream of −35. A second sequence-specific DNA-binding complex, PGTF, binds upstream of AGF between −71 and −100 in the barley (Hordeum vulgare) psbD BLRP. In this study we report that ADP-dependent phosphorylation selectively inhibits the binding of PGTF to the barley psbD BLRP. ATP at high concentrations (1–5 mm) inhibits PGTF binding, but in the presence of phosphocreatine and phosphocreatine kinase, this capacity is lost, presumably due to scavenging of ADP. ADP inhibits PGTF binding at relatively low concentrations (0.1 mm), whereas other nucleotides are unable to mediate this response. ADP-mediated inhibition of PGTF binding is reduced in the presence of the protein kinase inhibitor K252a. This and other results suggest that ADP-dependent phosphorylation of PGTF (or some associated protein) inhibits binding of PGTF to the psbD BLRP and reduces transcription. ADP-dependent phosphorylation is expected to increase in darkness in parallel with the rise in ADP levels in chloroplasts. ADP-dependent phosphorylation in chloroplasts may, therefore, in coordination, inactivate enzymes involved in carbon assimilation, protein synthesis, and transcription during diurnal light/dark cycles.

Replicating satellite RNA induces sequence-specific DNA methylation and truncated transcripts in plants

Tobacco plants were transformed with a chimeric transgene comprising sequences encoding β-glucuronidase (GUS) and the satellite RNA (satRNA) of cereal yellow dwarf luteovirus. When transgenic plants were infected with potato leafroll luteovirus (PLRV), which replicated the transgene-derived satRNA to a high level, the satellite sequence of the GUS:Sat transgene became densely methylated. Within the satellite region, all 86 cytosines in the upper strand and 73 of the 75 cytosines in the lower strand were either partially or fully methylated. In contrast, very low levels of DNA methylation were detected in the satellite sequence of the transgene in uninfected plants and in the flanking nonsatellite sequences in both infected and uninfected plants. Substantial amounts of truncated GUS:Sat RNA accumulated in the satRNA-replicating plants, and most of the molecules terminated at nucleotides within the first 60 bp of the satellite sequence. Whereas this RNA truncation was associated with high levels of satRNA replication, it appeared to be independent of the levels of DNA methylation in the satellite sequence, suggesting that it is not caused by methylation. All the sequenced GUS:Sat DNA molecules were hypermethylated in plants with replicating satRNA despite the phloem restriction of the helper PLRV. Also, small, sense and antisense ∼22 nt RNAs, derived from the satRNA, were associated with the replicating satellite. These results suggest that the sequence-specific DNA methylation spread into cells in which no satRNA replication occurred and that this was mediated by the spread of unamplified satRNA and/or its associated 22 nt RNA molecules.

Distamycin A affects the stability of NF-kappaB p50-DNA complexes in a sequence-dependent manner

The effect of two different DNA minor groove binding molecules, Hoechst 33258 and distamycin A, on the binding kinetics of NF-κB p50 to three different specific DNA sequences was studied at various salt concentrations. Distamycin A was shown to significantly increase the dissociation rate constant of p50 from the sequences PRDII (5′-GGGAAATTCC-3′) and Ig-κ B (5′-GGGACTTTCC-3′) but had a negligible effect on the dissociation from the palindromic target-κB binding site (5′-GGGAATTCCC-3′). By comparison, the effect of Hoechst 33258 on binding of p50 to each sequence was found to be minimal. The dissociation rates for the protein–DNA complexes increased at higher potassium chloride concentrations for the PRDII and Ig-κB binding motifs and this effect was magnified by distamycin A. In contrast, p50 bound to the palindromic target-κB site with a much higher intrinsic affinity and exhibited a significantly reduced salt dependence of binding over the ionic strength range studied, retaining a KD of less than 10 pM at 150 mM KCl. Our results demonstrate that the DNA binding kinetics of p50 and their salt dependence is strongly sequence-dependent and, in addition, that the binding of p50 to DNA can be influenced by the addition of minor groove-binding drugs in a sequence-dependent manner.

Sequence specific interaction of Mycobacterium smegmatis topoisomerase I with duplex DNA

We have identified strong topoisomerase sites (STS) for Mycobacteruim smegmatis topoisomerase I in double-stranded DNA context using electrophoretic mobility shift assay of enzyme-DNA covalent complexes; Mg2+, an essential component for DNA relaxation activity of the enzyme, is not required for binding to DNA, The enzyme makes single-stranded nicks, with transient covalent interaction at the 5'-end of the broken DNA strand, a characteristic akin to prokaryotic topoisomerases. More importantly, the enzyme binds to duplex DNA having a preferred site with high affinity, a. property similar to the eukaryotic type I topoisomerases, The preferred cleavage site is mapped on a 65 bp duplex DNA and found to be CG/TCTT. Thus, the enzyme resembles other prokaryotic type I topoisomerases in mechanistics of the reaction, but is similar to eukaryotic enzymes in DNA recognition properties.

Sequence-dependent conformation of an A-DNA double helix: The crystal structure of the octamer d(G-G-T-A-T-A-C-C)

The crystal structures of the synthetic self-complementary octamer d(G-G-T-A-T-A-C-C) and its 5-bromouracil-containing analogue have been refined to R values of 20% and 14% at resolutions of 1·8 and 2·25 Å, respectively. The molecules adopt an A-DNA type double-helical conformation, which is minimally affected by crystal forces. A detailed analysis of the structure shows a considerable influence of the nucleotide sequence on the base-pair stacking patterns. In particular, the electrostatic stacking interactions between adjacent guanine and thymine bases produce symmetric bending of the double helix and a major-groove widening. The sugar-phosphate backbone appears to be only slightly affected by the base sequence. The local variations in the base-pair orientation are brought about by correlated adjustments in the backbone torsion angles and the glycosidic orientation. Sequence-dependent conformational variations of the type observed here may contribute to the specificity of certain protein-DNA interactions.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Sequence Specific Interaction between Promoter DNA and Escherichia coli RNA Polymerase: Comparative Thermodynamic Analysis with One Immobilized Partner

Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.

Sequence specificity of Z-DNA formation in oligonucleotides

The sequence specific requirement for B----Z transition in solution was examined in d(CGTGCGCACG), d(CGTACGTACG), d(ACGTACGT) in presence of various Z-inducing factors. Conformational studies show that inspite of the alternating nature of purines and pyrimidines, the aforementioned sequences do not undergo B----Z transition under the influence of NaCl, hexamine cobalt chloride and ethanol. A comparison with the crystal structures of an assorted array of purine and pyrimidine sequences show that the sequence requirement for B----Z transition is much more stringent in solution as compared to the solid state. The disruptive influence of AT base pairs in B to Z transition is discussed.

A hypothesis on a specific sequence-dependent conformation of DNA and its relation to the binding of the lac-repressor protein

The structure and properties of the double-helical form of the alternating copolymer poly(dA-dT) are considered. Different lines of evidence are interpreted in terms of a structure in which every second phosphate-diester linkage has a conformation different from that of the normal B form. A rationale for this “alternating-B” structure is given which provides an explanation for the effects of chemical modifications of the T residues on the binding of the poly(dA-dT)· poly(dA-dT) to the lac repressor of Escherichia coli.

Structural features of B-DNA dodecamer crystal structures: Influence of crystal packing versus base sequence

We have analyzed the set of inter and intra base pair parameters for each dinucleotide step in single crystal structures of dodecamers, solved at high and medium resolution and all crystallized in P2(1)2(1)2(1) space group. The objective was to identify whether all the structures which have either the Drew-Dickerson (DD) sequence d[CGCGAATTCGCG] with some base modification or related sequence (non-DD), would display the same sequence dependent structural variability about its palindromic sequence, despite the molecule being bent at one end because of similar crystal lattice packing effect. Most of the local doublet parameters for base pairs steps G2-C3 and G10-C11 positions, symmetrically situated about the lateral twofold, were significantly correlated between themselves. In non-DD sequences, significant correlations between these positional parameters were absent. The different range of local step parameter values at each sequence position contributed to the gross feature of smooth helix axis bending in all structures. The base pair parameters in some of the positions, for medium resolution DD sequence, were quite unlike the high-resolution set and encompassed a higher range of values. Twist and slide are the two main parameters that show wider conformational range for the middle region of non-DD sequence structures in comparison to DD sequence structures. On the contrary, the minor and major groove features bear good resemblance between DD and non-DD sequence crystal structure datasets. The sugar-phosphate backbone torsion angles are similar in all structures, in sharp contrast to base pair parameter variation for high and low resolution DD and non-DD sequence structures, consisting of unusual (epsilon =g(-), xi =t) B-II conformation at the 10(th) position of the dodecamer sequence. Thus examining DD and non-DD sequence structures packed in the same crystal lattice arrangement, we infer that inter and intra base pair parameters are as symmetrically equivalent in its value as the symmetry related step for the palindromic DD sequence about lateral two-fold axis. This feature would lead us to agree with the conclusion that DNA conformation is not substantially affected by end-to-end or lateral inter-molecular interaction due to crystal lattice packing effect. Non-DD sequence structures acquire step parameter values which reflect the altered sequence at each of the dodecamer sequence position in the orthorhombic lattice while showing similar gross features of DD sequence structures

Local variability and base sequence effects in DNA crystal structures.

The importance and usefulness of local doublet parameters in understanding sequence dependent effects has been described for A- and B-DNA oligonucleotide crystal structures. Each of the two sets of local parameters described by us in the NUPARM algorithm, namely the local doublet parameters, calculated with reference to the mean z-axis, and the local helical parameters, calculated with reference to the local helix axis, is sufficient to describe the oligonucleotide structures, with the local helical parameters giving a slightly magnified picture of the variations in the structures. The values of local doublet parameters calculated by NUPARM algorithm are similar to those calculated by NEWHELIX90 program, only if the oligonucleotide fragment is not too distorted. The mean values obtained using all the available data for B-DNA crystals are not significantly different from those obtained when a limited data set is used, consisting only of structures with a data resolution of better than 2.4 A and without any bound drug molecule. Thus the variation observed in the oligonucleotide crystals appears to be independent of the quality of their crystallinity. No strong correlation is seen between any pair of local doublet parameters but the local helical parameters are interrelated by geometric relationships. An interesting feature that emerges from this analysis is that the local rise along the z-axis is highly correlated with the difference in the buckle values of the two basepairs in the doublet, as suggested earlier for the dodecamer structures (Bansal and Bhattacharyya, in Structure & Methods: DNA & RNA, Vol. 3 (Eds., R.H. Sarma and M.H. Sarma), pp. 139-153 (1990)). In fact the local rise values become almost constant for both A- and B-forms, if a correction is applied for the buckling of the basepairs. In B-DNA the AA, AT, TA and GA basepair sequences generally have a smaller local rise (3.25 A) compared to the other sequences (3.4 A) and this seems to be an intrinsic feature of basepair stacking interaction and not related to any other local doublet parameter. The roll angles in B-DNA oligonucleotides have small values (less than +/- 8 degrees), while mean local twist varies from 24 degrees to 45 degrees. The CA/TG doublet sequences show two types of preferred geometries, one with positive roll, small positive slide and reduced twist and another with negative roll, large positive slide and increased twist.(ABSTRACT TRUNCATED AT 400 WORDS)

CA/TG sequence at the 5' end of oligo(A)-tracts strongly modulates DNA curvature

An analysis of the base pair doublet geometries in available crystal structures indicates that the often reported intrinsic curvature of DNA containing oligo-(d(A).d(T)) tracts may also depend on the nature of the flanking sequences. The presence of CA/TG doublet in particular at the 5' end of these tracts is expected to enhance their intrinsic bending property. To test this proposition, three oligonucleotides, d(GAAAAACCCCCC), d(CCCCCCAAAAAG), d(GAAAAATTTTTC), and their complementary sequences were synthesized to study the effect of various flanking sequences, at the 5' and 3' ends of the A-tracts, on the curvature of DNA in solution. An analysis of the polyacrylamide gel electrophoretic mobilities of these sequences under different conditions of salts and temperatures (below their melting points) clearly showed that the oligomer with CA/TG sequence in the center was always more retarded than the oligomer with AC/GT sequence, as well as the oligomer with AT/AT sequence. Hydroxyl radical probing of the sequences with AC/GT and CA/TG doublet junctions gives a similar cutting pattern in the A-tracts, which is quite different from that in the C-tracts, indicating that the oligo(A)-tracts have similar structures in the two oligomers. KMnO4 probing shows that the oligomer with a CA/TG doublet junction forms a kink that is responsible for its inherent curvature and unusual electrophoretic mobility. UV melting shows a reduced thermal stability of the duplex with CA/TG doublet junction, and circular dichroism (CD) studies indicate that a premelting transition occurs in the oligomer with CA/TG doublet step before global melting but not in the oligomer with AC/GT doublet step, which may correspond to thermally induced unbending of the oligomer. These observations indicate that the CA/TG doublet junction at the 5' end of the oligo(A)-tract has a crucial role in modulating the overall curvature in DNA.

CA\TG Sequence at the 5'end of Oligo(A)-tracts Strongly Modulates DNA Curvature

An analysis of the base pair doublet geometries in available crystal structures indicates that the often reported intrinsic curvature of DNA containing oligo-(d(A).d(T)) tracts may also depend on the nature of the flanking sequences. The presence of CA/TG doublet in particular at the 5' end of these tracts is expected to enhance their intrinsic bending property. To test this proposition, three oligonucleotides, d(GAAAAACCCCCC), d(CCCCCCAAAAAG), d(GAAAAATTTTTC), and their complementary sequences were synthesized to study the effect of various flanking sequences, at the 5' and 3' ends of the A-tracts, on the curvature of DNA in solution. An analysis of the polyacrylamide gel electrophoretic mobilities of these sequences under different conditions of salts and temperatures (below their melting points) clearly showed that the oligomer with CA/TG sequence in the center was always more retarded than the oligomer with AC/GT sequence, as well as the oligomer with AT/AT sequence. Hydroxyl radical probing of the sequences with AC/GT and CA/TG doublet junctions gives a similar cutting pattern in the A-tracts, which is quite different from that in the C-tracts, indicating that the oligo(A)-tracts have similar structures in the two oligomers. KMnO4 probing shows that the oligomer with a CA/TG doublet junction forms a kink that is responsible for its inherent curvature and unusual electrophoretic mobility. UV melting shows a reduced thermal stability of the duplex with CA/TG doublet junction, and circular dichroism (CD) studies indicate that a premelting transition occurs in the oligomer with CA/TG doublet step before global melting but not in the oligomer with AC/GT doublet step, which may correspond to thermally induced unbending of the oligomer. These observations indicate that the CA/TG doublet junction at the 5' end of the oligo(A)-tract has a crucial role in modulating the overall curvature in DNA.