985 resultados para Thymidine Phosphorylase


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Particular interest has been directed towards the macrophage as a primary antineoplastic cell due to its tumoricidal properties in vitro and the observation that an inverse relationship exists between the number of macrophages infiltrating a tumor and metastatic potential. The mechanism of macrophage-mediated injury of tumor cells remains unknown. Recently, it has been shown that injured tumor cells have defective mitochondrial respiration. Our studies have shown that activated macrophages can release soluble factors which can alter tumor cell respiration.^ The effects of a conditioned supernatant (CS) from cultures of activated macrophages on tumor cell (TC) mitochondrial respiration was studied. CS was obtained by incubation of BCG-elicited, murine peritoneal macrophage with RPMI-1640 supplemented with 10% FCS and 50 ng/ml bacterial endotoxin. This CS was used to treat cultures of EMT-6 TC for 24 hours. Mitochondrial respiration was measured polarigraphically using a Clark-type oxygen electrode. Cell growth rate was assessed by ('3)H-Thymidine incorporation. Exposure of EMT-6 TC to CS resulted in the inhibition of malate and succinate oxidation 76.6% and 72.9%, respectively. While cytochrome oxidase activity was decreased 61.1%. This inhibition was accompanied by a 98.8% inhibition of DNA synthesis (('3)H-Thymidine incorporation). Inhibition was dose-related with a 21.3% inhibition of succinate oxidase from a 0.3 ml dose of CS and a 50% inhibition with 1.0 mls. Chromatography of CS on Sephacryl S-200 resulted in isolation of an 80,000 and a 55,000 dalton component which contained the respiration inhibiting activity (RIF). These factors were distinct from a 120,000 dalton cytolytic factor determined by bioassay on Actinomycin-D treated L929 cells. RIF activity was also distinct from several other cytostatic factors but was itself associated with 2 peaks of cytostatic activity. Characterization of the RIF activity showed that it was destroyed by trypsin and heat (100(DEGREES)C, 5 min). It was stable over a broad range of pH (4-9) and its production was inhibited by cycloheximide. The RIF did not have a direct effect on isolated mitochondria of TC nor did it induce the formation of a stable intracellular toxin for mitochondria.^ In conclusion, activated macrophages synthesize and secrete an 80,000 and a 55,000 dalton protein which inhibits the mitochondrial metabolism of TC. These factors induce a cytostatic but not a cytolytic effect on TC.^ The macrophage plays a role in the control of normal and tumor cell growth and in tissue involution. Inhibition of respiration may be one mechanism used by macrophages to control cell growth.^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Colorectal cancer is the number two cancer killer in the United States. Although primary colorectal cancer can be resected by surgery, patients often die from metastatic disease. Liver is the most common site of metastasis for colorectal cancer. It is difficult to selectively kill metastatic colon cancer cells without damaging normal liver functions. Thus it becomes a high priority to develop a selective targeting system for the treatment of colorectal cancer liver metastasis. ^ In the current study, a gene therapy strategy that allows a therapeutic gene to selectively destroy metastatic colon cancer cells without affecting normal liver cells is developed. The APC gene is frequently mutated in colorectal cancers. These mutations activate β-catenin responsive promoters. An optimized β-catenin responsive promoter, containing TCF consensus binding sites, was engineered for this study. This TCF promoter was found to express preferentially in APC mutated/β-catenin activated colorectal cancers while maintaining a low expression level in cell lines of liver origin. A recombinant adenoviral vector AdTCF-TK, in which the TCF promoter controls expression of the herpes simplex virus thymidine kinase gene, selectively destroyed colorectal cancer cells in vitro. AdTCF-TK virus and ganciclovir treatment also inhibited the growth of solid tumour derived from the colon cancer cell line DLD-1 in nude mice. In a control experiment, the growth inhibition effect of the same virus was attenuated in a liver cancer cell line. ^ In the present study, a novel method was developed to target therapeutic gene expression to colon cancer cells at reduced liver toxicity to the patients. The same gene therapy design may also be applied to treat tumours carrying mutations in the β-catenin gene, which is a central component of the APC signal transduction pathway. In summary, the principle for a rational design of a cancer specific treatment approach is demonstrated in this study. In the future, mutations in cancer patients will be more easily identified. Using the same principle developed in this study, specific regimen can be designed to treat these patients based on the specific genetic changes found in the tumour. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Thiazolidinediones (TZDs), a novel class of anti-diabetic drugs, have been known as ligands of peroxisome proliferator-activated receptor γ (PPARγ), a transcription factor that belongs to the nuclear receptor superfamily. These synthetic compounds improve insulin sensitivity in patients with type II diabetes likely through activating PAPRγ. Interestingly, they were also shown to inhibit cell growth and proliferation in a wide variety of tumor cell lines. The aim of this study is to assess the potential use of TZDs in the prevention of carcinogenesis using mouse skin as a model. ^ We found that troglitazone, one of TZD drugs, strongly inhibited cultured mouse skin keratinocyte proliferation as demonstrated by [3H]thymidine incorporation assay. It also induced a cell cycle G1 phase arrest and inhibited expression of cell cycle proteins, including cyclin D1, cdk2 and cdk4. Further experiments showed that PPARγ expression in keratinocytes was surprisingly undetectable in vitro or in vivo. Consistent with this, no endogenous PPARγ function in keratinocytes was found, suggesting that the inhibition of troglitazone on keratinocyte proliferation and cell cycle was PPARγ-independent. We further found that troglitazone inhibited insulin/insulin growth factor I (IGF-1) mitogenic signaling, which may explains, at least partly, its inhibitory effect on keratinocyte proliferation. We showed that troglitazone rapidly inhibited IGF-1 induced phosphorylation of p70S6K by mammalian target of rapamycin (mTOR). However, troglitazone did not directly inhibit mTOR kinase activity as shown by in vitro kinase assay. The inhibition of p70S6K is likely to be the result of strong activation of AMP activated protein kinase (AMPK) by TZDs. Stable expression of a dominant negative AMPK in keratinocytes blocked the inhibitory effect of troglitazone on IGF-1 induced phosphorylation of p70S6K. ^ Finally, we found that dietary TZDs inhibited by up to 73% mouse skin tumor development promoted by elevated IGF-1 signaling in BK5-IGF-1 transgenic mice, while they had no or little effect on skin tumor development promoted by 12-O-tetradecanoylphorbol-13-acetate (TPA) or ultraviolet (UV). Since IGF-1 signaling is frequently found to be elevated in patients with insulin resistance and in many human tumors, our data suggest that TZDs may provide tumor preventive benefit particularly to these patients. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The effect of circadian variation on susceptibility to the chemical induction of cancer was assessed utilizing the mouse pulmonary adenoma bioassay. Different groups of male A/Jax mice (standardized for rhythm analysis with light from 0600-1800 and darkness from 1800-0600) each received a single timed i.p. injection of urethan (Bioassay I: 0.25, 0.5 or 1.0 mg/g body weight; Bioassay II: 0.75, 1.0, 1.25 mg/g body weight; Bioassay III: 1.0 mg/g body weight) at the following times, 0100, 0500, 0900, 1300, 1700 or 2100. Mice were sacrificed 16 weeks after treatment. The tumorigenic effect of urethan on the lungs (lung surface pulmonary adenomas) was assessed. In addition, mortality, body weight changes and the anesthetic effect of urethan were determined. The rhythmic pattern of DNA synthesis in the lung and the comparative rhythmic pattern in the liver were assessed using a tritiated thymidine incorporation assay.^ In the first adenoma bioassay, the lung tumorigenic response in mice given the highest dose of urethan exhibited a 12-hour rhythm with a major peak in tumor yield at 0100 and a secondary peak at 1300; reduced yields occurred at 0500-0900 and 2100. The second adenoma bioassay, studied at a 6-month seasonal divergence in time from the first study showed a peak at 1300 but not at 0100. The mice from the third adenoma bioassay, studied at an 11-month seasonal divergence in time from the 2nd study showed an increase in tumor yield during the rest cycle (0900-1700).^ This study found a definite suggestion of a low amplitude rhythm in susceptibility to urethan induced effects. The acute toxic and pharmacological effects correlated to exhibit a maximal effect during dark hours (activity span). This rhythmicity might be explained by an alteration in the amplitude of hepatic metabolism. The chronic carcinogenic response exhibited an opposite pattern. Urethan induced tumor response was greater during daylight hours (rest cycle). This correlated with the slight elevation in DNA synthetic activity found in the lung and liver which might be responsible for the increase in carcinogenic response. (Abstract shortened with permission of author.) ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The non-Hodgkin's B cell lymphomas are a diverse group of neoplastic diseases. The incidence rate of the malignant tumors has been rising rapidly over the past twenty years in the United States and worldwide. The lack of insight to pathogenesis of the disease poses a significant problem in the early detection and effective treatment of the human malignancies. These studies attempted to investigate the molecular basis of pathogenesis of the human high grade B cell non-Hodgkin's lymphomas with a reverse genetic approach. The specific objective was to clone gene(s) which may play roles in development and progression of human high grade B cell non-Hodgkin's lymphomas.^ The messenger RNAs from two high grade B cell lymphoma lines, CJ and RR, were used for construction of cDNA libraries. Differential screening of the derived cDNA libraries yielded a 1.4 kb cDNA clone. The gene, designated as NHL-B1.4, was shown to be highly amplified and over-expressed in the high grade B cell lymphoma lines. It was not expressed in the peripheral blood lymphoid cells from normal donors. However, it was inducible in peripheral blood T lymphocytes by a T cell mitogen, PHA, but could not be activated in normal B cells by B cell mitogen PMA. Further molecular characterization revealed that the gene may have been rearranged in the RR and some other B cell lymphoma lines. The coding capacity of the cDNA has been confirmed by a rabbit reticulocyte lysate and wheat germ protein synthesis system. A recombinant protein with a molecular weight of approximate 30 kDa was visualized in autoradiogram. Polyclonal antisera have been generated by immunization of two rabbits with the NHL-B1.4 recombinant protein produced in the E. coli JM109. The derived antibody can recognize a natural protein with molecular weight of 49 kDa in cell lysate of activated peripheral T lymphocytes of normal donors and both the cell lysate and supernatant of RR B cell lymphoma lines. The possible biologic functions of the molecule has been tested preliminarily in a B lymphocyte proliferation assay. It was found that the Q-sepharose chromatograph purified supernatant of COS cell transfection could increase tritiated thymidine uptake by B lymphocytes but not by T lymphocytes. The B cell stimulatory activity of the supernatant of COS cell tranfection could be neutralized by the polyclonal antisera, indicating that the NHL-B1.4 gene product may be a molecule with BCGF-like activity.^ The expression profiles of NHL-B1.4 in normal and neoplastic lymphoid cells were consistent with the current B lymphocyte activation model and autocrine hypothesis of high grade B cell lymphomagenesis. These results suggested that the NHL-B1.4 cDNA may be a disease-related gene of human high grade B cell lymphomas, which may codes for a postulated B cell autocrine growth factor. ^

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^