976 resultados para Glycine-rich protein


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the replication terminator protein (RTP) and DNA terminator sites. While determination of the crystal structure of RTP has facilitated our understanding of how a single RTP dimer interacts with terminator DNA, additional information is required in order to understand the assembly of a functional fork arrest complex, which requires an interaction between two RTP dimers and the terminator site. In this study, we show that the conformation of the major B. subtilis DNA terminator, Terl, becomes considerably distorted upon binding RTP. Binding of the first dimer of RTP to the B site of Terl causes the DNA to become slightly unwound and bent by similar to 40 degrees. Binding of a second dimer of RTP to the A site causes the bend angle to increase to similar to 60 degrees. We have used this new data to construct two plausible models that might explain how the ternary terminator complex can block DNA replication in a polar manner, in the first model, polarity of action is a consequence of the two RTP-DNA half-sites having different conformations. These different conformations result from different RTP-DNA contacts at each half-site (due to the intrinsic asymmetry at the terminator DNA), as well as interactions (direct or indirect) between the RTP dimers on the DNA. In the second model, polar fork arrest activity is a consequence of the different affinities of RTP for the A and B sites of the terminator DNA, modulated significantly by direct or indirect interactions between the RTP dimers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mechanisms of leukocyte NADPH oxidase regulation remain actively investigated. We showed previously that vascular and macrophage oxidase complexes are regulated by the associated redox chaperone PDI. Here, we investigated the occurrence and possible underlying mechanisms of PDI-mediated regulation of neutrophil NADPH oxidase. In a semirecombinant cell-free system, PDI inhibitors scrRNase (100 mu g/mL) or bacitracin (1 mM) near totally suppressed superoxide generation. Exogenously incubated, oxidized PDI increased (by similar to 40%), whereas PDIred diminished (by similar to 60%) superoxide generation. No change occurred after incubation with PDI serine-mutated in all four redox cysteines. Moreover, a mimetic CxxC PDI inhibited superoxide production by similar to 70%. Thus, oxidized PDI supports, whereas reduced PDI down-regulates, intrinsic membrane NADPH oxidase complex activity. In whole neutrophils, immunoprecipitation and colocalization experiments demonstrated PDI association with membrane complex subunits and prominent thiol-mediated interaction with p47(phox) in the cytosol fraction. Upon PMA stimulation, PDI was mobilized from azurophilic granules to cytosol but did not further accumulate in membranes, contrarily to p47(phox). PDI-p47(phox) association in cytosol increased concomitantly to opposite redox switches of both proteins; there was marked reductive shift of cytosol PDI and maintainance of predominantly oxidized PDI in the membrane. Pulldown assays further indicated predominant association between PDIred and p47(phox) in cytosol. Incubation of purified PDI (> 80% reduced) and p47(phox) in vitro promoted their arachidonate-dependent association. Such PDI behavior is consistent with a novel cytosolic regulatory loop for oxidase complex (re) cycling. Altogether, PDI seems to exhibit a supportive effect on NADPH oxidase activity by acting as a redox-dependent enzyme complex organizer. J. Leukoc. Biol. 90: 799-810; 2011.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Extraction of intracellular protein from Escherichia coli is traditionally achieved by mechanical disruption. A chemical treatment that destroys the integrity of the bacterial cell wall and could provide an alternative technique is examined in this study. Treatment with a combination of the chelating agent ethylenediaminetetraacetate (EDTA) (greater than 0.3 mM) and the chaotropic agent urea (6 M) is highly effective at releasing protein from uninduced E. coli. The 6 M urea in the presence of 3 mM EDTA can release cytoplasmic protein from both logarithmic-phase and stationary-phase E. coli cells at levels equivalent to mechanical disruption. The concentrations of the two chemical agents were the major variables affecting the maximum levels of protein release. Several minor variables and interactions were also identified. The kinetics of protein release is first order. For 2, 4, and 6 M urea with 3 mM EDTA, the time constant is approximately 2.5 min independent of urea concentration. Kinetics for 3 mM EDTA without urea is considerably slower, with a time constant of 12.3 min. (C) 1997 John Wiley & Sons, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context: Thyroglobulin (TG) is a large glycoprotein and functions as a matrix for thyroid hormone synthesis. TG gene mutations give rise to goitrous congenital hypothyroidism (CH) with considerable phenotype variation. Objectives: The aim of the study was to report the genetic screening of 15 patients with CH due to TG gene mutations and to perform functional analysis of the p. A2215D mutation. Design: Clinical evaluation and DNA sequencing of the TG gene were performed in all patients. TG expression was analyzed in the goitrous tissue of one patient. Human cells were transfected with expression vectors containing mutated and wild-type human TG cDNA. Results: All patients had an absent rise of serum TG after stimulation with recombinant human TSH. Sequence analysis revealed three previously described mutations (p. A2215D, p. R277X, and g. IVS30 + 1G > T), and two novel mutations (p. Q2142X and g. IVS46-1G > A). Two known (g. IVS30 + 1G/p. A2215D and p. A2215D/p. R277X) and one novel (p. R277X/g. IVS46-1G > A) compound heterozygous constellations were also identified. Functional analysis indicated deficiency in TG synthesis, reduction of TG secretion, and retention of the mutant TG within the cell, leading to an endoplasmic reticulum storage disease, whereas small amounts of mutant TG were still secreted within the cell system. Conclusion: All studied patients were either homozygous or heterozygous for TG gene mutations. Two novel mutations have been detected, and we show that TG mutation p. A2215D promotes the retention of TG within the endoplasmic reticulum and reduces TG synthesis and secretion, causing mild hypothyroidism. In the presence of sufficient iodine supply, some patients with TG mutations are able to compensate the impaired hormonogenesis and generate thyroid hormone. (J Clin Endocrinol Metab 94: 2938-2944, 2009)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chloramphenicol acetyl transferase (CAT) protein and mRNA levels in E. coli were determined following induction of a tac::cat construct by isopropyl-beta-thiogalactopyranoside (IPTG). High cat mRNA levels did not directly reflect CAT protein levels, in either shakeflask experiments or fermentations. Furthermore, concentrations of IPTG resulting in the highest levels of expression of cat mRNA, were different to those resulting in highest levels of CAT protein. The data suggest that high transcriptional activities lead to limitations at the translational level.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: p63 gene is a p53 homologue that encodes proteins with transactivation, DNA-binding and tetramerisation domains. The isoforms TAp63 and TAp73 transactivate p53 target genes and induce apoptosis, whereas the isoforms Delta Np63 and Delta Np73 lack transactivation and might have dominant-negative effects in p53 family members. p63 is expressed in germinal centre lymphocytes and can be related to the development of the lymphoma, but the prognostic significance of its expression in the survival of patients with diffuse large B-cell lymphoma (DLBCL) remains unclear. Aims: To determine whether quantitative immunohistochemical (IHC) analysis of p63 protein expression correlates with CD10 antigen, Bcl-6 antigen and IRF4 antigen expression and to determine whether p63 is a surrogate predictor of overall survival in high-intermediate and high risk DLBCL populations. Methods: CD10, Bcl-6 and IRF4 expression were retrospectively evaluated by IHC in 73 samples of high intermediate and high risk DLBCL and were used to divide the lymphomas into subgroups of germinal centre B-celllike (GCB) and activate B-cell-like (ABC) DLBCL. Similarly, p63 expression was evaluated by IHC and the results were compared with subgroups of DLBCL origin and with the survival rates for these patients. Results: p63 was expressed in more than 50% of malignant cells in 11 patients and did not show correlation with subgroups of GCB-like DLBCL or ABC-like DLBCL, but p63(+) patients had better disease-free survival (DFS) than those who were negative (p = 0.01). Conclusions: p63(+) high-intermediate and high risk DLBCL patients have a better DFS than negative cases.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Although inflammation has a defined role in the pathogenesis of atherosclerosis, the link between rheumatoid arthritis (RA) parameters of disease activity and atherosclerotic findings are not defined. Objective: To investigate the association between subclinical carotid atherosclerosis and clinical/laboratorial parameters of RA systemic inflammatory activity. Methods: Seventy-one RA patients were consecutively selected and compared to 53 healthy controls. Smoking, diabetes and hypertension were excluded, as well as the use of statins or fibrates. B-mode carotid ultrasound was performed in all subjects. CRP, ESR and fibrinogen were determined in both groups. Clinical assessment of RA activity included DAS 28 and SDAI. Correlation between plaques and intima-media thickness (IMT) of common carotid arteries and inflammatory parameters was evaluated. Results: Carotid plaques were more prevalent in RA patients than in controls (14.1% vs. 1.9 %, p=0.02) and marginally increased IMT was observed (0.72 +/- 0.17 vs. 0.67 +/- 0.15mm, p=0.07). RA patients with plaques had older age (p=0.001) and increased IMT (p<0.001), but low SDAI (p=0.025) compared to those without plaques. RA patients with plaques had also longer disease duration, although this difference did not reach statistical significance (p=0.06). No significant correlations were found between IMT and ESR (p=0.80), CRP (p=0.75), fibrinogen (p=0.94), HAQ (p=0.89) and DAS 28 (p=0.13). Conclusions: Carotid atherosclerosis is more frequently detected in RA but its prevalence was not correlated with isolated inflammatory markers measurement or noncumulative activity scores. These findings reinforce the need to evaluate subclinical atherosclerosis in RA patients, and to find predictors of atherosclerotic lesions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We analyzed the effect of a 6-week aerobic exercise training program on the in vivo macrophage reverse cholesterol transport (RCT) in human cholesteryl ester transfer protein (CETP) transgenic (CETP-tg) mice. Male CETP-tg mice were randomly assigned to a sedentary group or a carefully supervised exercise training group (treadmill 15 m/min, 30 min sessions, five sessions per week). The levels of plasma lipids were determined by enzymatic methods, and the lipoprotein profile was determined by fast protein liquid chromatography (FPLC). CETP activity was determined by measuring the transfer rate of (14)C-cholesterol from HDL to apo-B containing lipoproteins, using plasma from CETP-tg mice as a source of CETP. The reverse cholesterol transport was determined in vivo by measuring the [(3)H]-cholesterol recovery in plasma and feces (24 and 48 h) and in the liver (48 h) following a peritoneal injection of [(3)H]-cholesterol labeled J774-macrophages into both sedentary and exercise trained mice. The protein levels of liver receptors were determined by immunoblot, and the mRNA levels for liver enzymes were measured using RT-PCR. Exercise training did not significantly affect the levels of plasma lipids or CETP activity. The HDL fraction assessed by FPLC was higher in exercise-trained compared to sedentary mice. In comparison to the sedentary group, a greater recovery of [(3)H]-cholesterol from the injected macrophages was found in the plasma, liver and feces of exercise-trained animals. The latter occurred even with a reduction in the liver CYP7A1 mRNA level in exercised trained animals. Exercise training increased the liver LDL receptor and ABCA-1 protein levels, although the SR-BI protein content was unchanged. The RCT benefit in CETP-tg mice elicited by exercise training helps to elucidate the role of exercise in the prevention of atherosclerosis in humans.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mice expressing human cholesteryl ester transfer protein (huCETP) are more resistant to Escherichia coli bacterial wall LIPS because death rates 5 days after intraperitoneal inoculation of LIPS were higher in wild-type than in huCETP(+/-) mice, whereas all huCETP(+/+) mice remained alive. After LIPS inoculation, plasma concentrations of TNF-alpha and IL-6 increased less in huCETP(+/+) than in wild-type mice. LPS in vitro elicited lower TNF-alpha production by CETP expressing than by wild-type macrophages. In addition, TNF-alpha production by RAW 264.7 murine macrophages increased on incubation with LPS but decreased in a dose-dependent manner when human CETP was added to the medium. Human CETP in vitro enhanced the LIPS binding to plasma high-density lipoprotein/low-density lipoprotein. The liver uptake of intravenous infused C-14-LPS from Salmonella typhimurium was greater in huCETP(+/+) than in wild-type mice. Present data indicate for the first time that CETP is an endogenous component involved in the first line of defense against an exacerbated production of proinflammatory mediators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Dietary salt restriction has been reported to adversely modify the plasma lipoprotein profile in hypertensive and in normotensive subjects. We investigated the effects of the low sodium intake (LSI) on the plasma lipoprotein profile and on inflammation and thrombosis biomarkers during the fasting and postprandial periods. Methods: Non-obese, non-treated hypertensive adults (n=41) were fed strictly controlled diets. An initial week on a control diet (CID, Na=160 mmol/day) was followed by 3 weeks on LSI (Na=60mmol/day). At admission and on the last day of each period, the 24-h ambulatory blood pressure was monitored and blood was drawn after an overnight fasting period and after a fat-rich test meal. Results: The dietary adherence was confirmed by 24-h urinary sodium excretion. Fasting triglyceride (TG), chylomicron-cholesterol, hsC-reactive protein (CRP), tumor necrosis factor-a (TNF-alpha). interleukin-6 (IL-6) concentrations, renin activity, aldosterone, insulin, and homeostasis model assessment insulin resistance (HOMA-IR) Values were higher, but non-esterified fatty acids (NEFA) were lower on LSI than on CD. For LSI, areas under the curve (AUC) of TG, chylomicron-cholesterol, apoB and the cholesterol/apoB ratio were increased, whereas AUC-NEFA was lowered. LSI did not modify body weight, hematocrit, fasting plasma cholesterol, glucose, adiponectin, leptin, fibrinogen and factor VII (FVII), and AUC of lipoprotein lipase and of lipoprotein remnants. Conclusion: LSI induced alterations in the plasma lipoproteins and in inflammatory markers that are common features of the metabolic syndrome. (C) 2008 Elsevier Ireland Ltd. All rights reserved.