Application of integrated GPS and GIS technology for reducing construction waste and improving construction efficiency

This paper presents a study on applying an integrated Global Position System (GPS) and Geographacial Information System (GIS) technology to the reduction of construction waste. During the study, a prototype study is developed from automatic data capture system such as the barcoding system for construction material and equipment (M&E) management onsite, whilst the integrated GPS and GIS technology is combined to the M&E system based on the Wide Area Network (WAN). Then, a case study is conducted to demonstrate the deployment of the system. Experimental results indicate that the proposed system can minimize the amount of onsite material wastage.

An investigation of the existing situation and trends in building energy efficiency management in China

According to the Chinese State Council's "Building Energy Efficiency Management Ordinance", a large-scale investigation of energy efficiency (EE) in buildings in contemporary China has been carried out in 22 provincial capitals and major cities in China. The aim of this project is to provide reliable information for drawing up the "Decision on reinforcing building energy efficiency" by the Ministry of Construction of China. The surveyed organizations include government departments, research institutions, property developers, design institutions, construction companies, construction consultancy services companies, facility management departments, financial institutions and those which relate to the business of building energy efficiency. In addition, representatives of the media and residents were also involved. A detailed analysis of the results of the investigation concerning aspects of the cur-rent situation and trends in building energy consumption, energy efficiency strategy and the implementation of energy efficiency measures has been conducted. The investigation supplies essential information to formulate the market entrance policy for new buildings and the refurbishment policy for existing buildings to encourage the development of energy efficient technology.

Beak trimming reduces feeding efficiency of hens

The ability of beak-trimmed and intact laying hens to ingest feed pellets was examined by highspeed video filming of feeding birds. The birds were exposed to either a deep layer of pellets or a single layer of pellets. In the single layer treatment, there was a negative correlation between mandible asymmetry and feeding success. These data have important implications for poultry welfare, since the degree of bill asymmetry caused by beak trimming may, under certain circumstances, result in inadvertent feed deprivation.

A method of weighting indicators in building energy efficiency assessment

This paper identifies the indicators of energy efficiency assessment in residential building in China through a wide literature review. Indicators are derived from three main sources: 1) The existing building assessment methods; 2)The existing Chinese standards and technology codes in building energy efficiency; 3)Academia research. As a result, we proposed an indicator list by refining the indicators in the above sources. Identified indicators are weighted by the group analytic hierarchy process (AHP) method. Group AHP method is implemented following key steps: Step 1: Experienced experts are selected to form a group; Step 2: A survey is implemented to collect the individual judgments on the importance of indicators in the group; Step 3: Members’ judgments are synthesized to the group judgments; Step 4: Indicators are weighted by AHP on the group judgments; Step 5: Investigation of consistency estimation shows that the consistency of the judgment matrix is accepted. We believe that the weighted indicators in this paper will provide important references to building energy efficiency assessment.

Urbanisation and its impact on building energy consumption and efficiency in China

The People's Republic of China and its 1.3 billion people have experienced a rapid economic growth in the past two decades. China's urbanisation ratio rose from around 20% in the early 1980s to 45% in 2007 [China Urban Research Committee. Green building. Beijing: Chinese Construction Industrial Publish House; 2008. ISBN 978-7-112-09925-2.]. The large volume and rapid speed of building construction rarely have been seen in global development and cause substantial pressure on resources and the environment. Government policy makers and building professionals, including architects, building engineers, project managers and property developers, should play an important role in enhancing the planning, design, construction, operation and maintenance of the building energy efficiency process in forming the sustainable urban development. This paper addresses the emerging issues relating to building energy consumption and building energy efficiency due to the fast urbanisation development in China.

ExtSym: a program to aid space-group determination from powder diffraction data

Once unit-cell dimensions have been determined from a powder diffraction data set and therefore the crystal system is known (e.g. orthorhombic), the method presented by Markvardsen, David, Johnson & Shankland [Acta Cryst. (2001), A57, 47-54] can be used to generate a table ranking the extinction symbols of the given crystal system according to probability. Markvardsen et al. tested a computer program (ExtSym) implementing the method against Pawley refinement outputs generated using the TF12LS program [David, Ibberson & Matthewman (1992). Report RAL-92-032. Rutherford Appleton Laboratory, Chilton, Didcot, Oxon, UK]. Here, it is shown that ExtSym can be used successfully with many well known powder diffraction analysis packages, namely DASH [David, Shankland, van de Streek, Pidcock, Motherwell & Cole (2006). J. Appl. Cryst. 39, 910-915], FullProf [Rodriguez-Carvajal (1993). Physica B, 192, 55-69], GSAS [Larson & Von Dreele (1994). Report LAUR 86-748. Los Alamos National Laboratory, New Mexico, USA], PRODD [Wright (2004). Z. Kristallogr. 219, 1-11] and TOPAS [Coelho (2003). Bruker AXS GmbH, Karlsruhe, Germany]. In addition, a precise description of the optimal input for ExtSym is given to enable other software packages to interface with ExtSym and to allow the improvement/modification of existing interfacing scripts. ExtSym takes as input the powder data in the form of integrated intensities and error estimates for these intensities. The output returned by ExtSym is demonstrated to be strongly dependent on the accuracy of these error estimates and the reason for this is explained. ExtSym is tested against a wide range of data sets, confirming the algorithm to be very successful at ranking the published extinction symbol as the most likely. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A differential thermal expansion approach to crystal structure determination from powder diffraction data

Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved

Structure determination from powder diffraction data

Advances made over the past decade in structure determination from powder diffraction data are reviewed with particular emphasis on algorithmic developments and the successes and limitations of the technique. While global optimization methods have been successful in the solution of molecular crystal structures, new methods are required to make the solution of inorganic crystal structures more routine. The use of complementary techniques such as NMR to assist structure solution is discussed and the potential for the combined use of X-ray and neutron diffraction data for structure verification is explored. Structures that have proved difficult to solve from powder diffraction data are reviewed and the limitations of structure determination from powder diffraction data are discussed. Furthermore, the prospects of solving small protein crystal structures over the next decade are assessed.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Jpowder: a Java-based program for the display and examination of powder diffraction data

The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.

A framework for comparing pollinator performance: effectiveness and efficiency

Measuring pollinator performance has become increasingly important with emerging needs for risk assessment in conservation and sustainable agriculture that require multi-year and multi-site comparisons across studies. However, comparing pollinator performance across studies is difficult because of the diversity of concepts and disparate methods in use. Our review of the literature shows many unresolved ambiguities. Two different assessment concepts predominate: the first estimates stigmatic pollen deposition and the underlying pollinator behaviour parameters, while the second estimates the pollinator’s contribution to plant reproductive success, for example in terms of seed set. Both concepts include a number of parameters combined in diverse ways and named under a diversity of synonyms and homonyms. However, these concepts are overlapping because pollen deposition success is the most frequently used proxy for assessing the pollinator’s contribution to plant reproductive success. We analyse the diverse concepts and methods in the context of a new proposed conceptual framework with a modular approach based on pollen deposition, visit frequency, and contribution to seed set relative to the plant’s maximum female reproductive potential. A system of equations is proposed to optimize the balance between idealised theoretical concepts and practical operational methods. Our framework permits comparisons over a range of floral phenotypes, and spatial and temporal scales, because scaling up is based on the same fundamental unit of analysis, the single visit.