1000 resultados para DNA-Schäden
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Kirjoitus on lisäys professorien Olli Halkan ja Veikko Sorsan artikkeleihin TT -lehdessä 2 ja 3/2004.
Resumo:
Vastine Olli Halkan kirjoitukseen TT -lehdessä 2/2004
Resumo:
Vastine TT -lehden numerossa 8/2003 olleeseen Jani Rydmanin kommenttiin Pekkan Nuortevan Luonnon tutkijassa olleeseen artikkeliin
Resumo:
Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.
Resumo:
A general understanding of interactions between DNA andoppositely charged compounds forms the basis for developing novelDNA-based materials, including gel particles. The association strength,which is altered by varying the chemical structure of the cationiccosolute, determines the spatial homogeneity of the gelation process,creating DNA reservoir devices and DNA matrix devices that can bedesigned to release either single- (ssDNA) or double-stranded(dsDNA) DNA. This paper reviews the preparation of DNA gelparticles using surfactants, proteins and polysaccharides. Particlemorphology, swelling/dissolution behaviour, degree of DNAentrapment and DNA release responses as a function of the nature ofthe cationic agent used are discussed. Current directions in thehaemocompatible and cytotoxic characterization of these DNA gelparticles have been also included.
Resumo:
Owl pellets contain a good skeletal record of the small mammals consumed, and correspond to the undigested portions of prey which are regurgitated. These pellets are easy to find at the roosting site of owls. As it has been demonstrated that amplifiable DNA can be isolated from ancient bone remains, the possibility of using owl pellets as a source of DNA for small mammal genetics studies via the polymerase chain reaction has been investigated. The main uncertainties when isolating DNA from such a material are firstly the possibility that the extracted DNA would be too degraded during the digestion in the stomach of the owl, and secondly that extensive cross-contaminations could occur among the different prey consumed. The results obtained clearly demonstrate that cross-contamination does not occur, and that mitochondrial and nuclear DNA can be amplified using skulls of small mammals found in owl pellets as a source of DNA. The relative efficiency of two methods of DNA extraction is estimated and discussed. Thus, owl pellets represent a non-invasive sampling technique which provides a valuable source of DNA for studying population genetics of small mammals.
Resumo:
The intracellular location of nucleic acid sensors prevents recognition of extracellular self-DNA released by dying cells. However, on forming a complex with the endogenous antimicrobial peptide LL37, extracellular DNA is transported into endosomal compartments of plasmacytoid dendritic cells, leading to activation of Toll-like receptor-9 and induction of type I IFNs. Whether LL37 also transports self-DNA into nonplasmacytoid dendritic cells, leading to type I IFN production via other intracellular DNA receptors is unknown. Here we found that LL37 very efficiently transports self-DNA into monocytes, leading the production of type I IFNs in a Toll-like receptor-independent manner. This type I IFN induction was mediated by double-stranded B form DNA, regardless of its sequence, CpG content, or methylation status, and required signaling through the adaptor protein STING and TBK1 kinase, indicating the involvement of cytosolic DNA sensors. Thus, our study identifies a novel link between the antimicrobial peptides and type I IFN responses involving DNA-dependent activation of cytosolic sensors in monocytes.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
Wolfram syndrome is a progressive neurodegenerative disorder transmitted in an autosomal recessive mode. We report two Wolfram syndrome families harboring multiple deletions of mitochondrial DNA. The deletions reached percentages as high as 85-90% in affected tissues such as the central nervous system of one patient, while in other tissues from the same patient and from other members of the family, the percentages of deleted mitochondrial DNA genomes were only 1-10%. Recently, a Wolfram syndrome gene has been linked to markers on 4p16. In both families linkage between the disease locus and 4p16 markers gave a maximum multipoint lod score of 3.79 at theta = 0 (Pi<0.03) with respect to D4S431. In these families, the syndrome was caused by mutations in this nucleus-encoded gene which deleteriously interacts with the mitochondrial genome. This is the first evidence of the implication of both genomes in a recessive disease.
Resumo:
PURPOSE: To assess the usefulness of combining hyperthermia with a DNA repair inhibitor (double-strand break bait [Dbait]) and its potential application to radiofrequency ablation (RFA) in a preclinical model of human colorectal cancer. MATERIALS AND METHODS: The local ethics committee of animal experimentation approved all investigations. First, the relevance was assessed by studying the survival of four human colorectal adenocarcinoma cell cultures after 1 hour of hyperthermia at 41°C or 43°C with or without Dbait. Human colon adenocarcinoma cells (HT-29) were grafted subcutaneously into nude mice (n = 111). When tumors reached approximately 500 mm(3), mice were treated with Dbait alone (n = 20), sublethal RFA (n = 21), three different Dbait schemes and sublethal RFA (n = 52), or a sham treatment (n = 18). RFA was performed to ablate the tumor center alone. To elucidate antitumor mechanisms, 39 mice were sacrificed for blinded pathologic analysis, including assessment of DNA damage, cell proliferation, and tumor necrosis. Others were monitored for tumor growth and survival. Analyses of variance and log-rank tests were used to evaluate differences. RESULTS: When associated with mild hyperthermia, Dbait induced cytotoxicity in all tested colon cancer cell lines. Sublethal RFA or Dbait treatment alone moderately improved survival (median, 40 days vs 28 days for control; P = .0005) but combination treatment significantly improved survival (median, 84 days vs 40 days for RFA alone, P = .0004), with approximately half of the animals showing complete tumor responses. Pathologic studies showed that the Dbait and RFA combination strongly enhances DNA damage and coagulation areas in tumors. CONCLUSION: Combining Dbait with RFA sensitizes the tumor periphery to mild hyperthermia and increases RFA antitumor efficacy.
Resumo:
Comment on: Witz G, et al. Proc Natl Acad Sci USA 2011; 108:3608-11.
Resumo:
In the presence of 2-hydroxybiphenyl, the enhancer binding protein, HbpR, activates the sigma54-dependent P(hbpC) promoter and controls the initial steps of 2-hydroxybiphenyl degradation in Pseudomonas azelaica. In the activation process, an oligomeric HbpR complex of unknown subunit composition binds to an operator region containing two imperfect palindromic sequences. Here, the HbpR-DNA binding interactions were investigated by site-directed mutagenesis of the operator region and by DNA-binding assays using purified HbpR. Mutations that disrupted the twofold symmetry in the palindromes did not affect the binding affinity of HbpR, but various mutations along a 60 bp region, and also outside the direct palindromic sequences, decreased the binding affinity. Footprints of HbpR on mutant operator fragments showed that a partial loss of binding contacts occurs, suggesting that the binding of one HbpR 'protomer' in the oligomeric complex is impaired whilst leaving the other contacts intact. An HbpR variant, devoid of its N-terminal sensing A-domain, was unable to activate transcription from the hbpC promoter while maintaining protection of the operator DNA in footprints. Wild-type HbpR was unable to activate transcription from the hbpC promoter when delta A-HbpR was expressed in the same cell, suggesting the formation of (repressing) hetero-oligomers. This model implies that HbpR can self-associate on its operator DNA without effector recognition or ATP binding. Furthermore, our findings suggest that the N-terminal sensing domain of HbpR is needed to activate the central ATPase domain rather than to repress a constitutively active C domain, as is the case for the related regulatory protein XylR.
Resumo:
The Saccharomyces cerevisiae Dmc1 and Tid1 proteins are required for the pairing of homologous chromosomes during meiotic recombination. This pairing is the precursor to the formation of crossovers between homologs, an event that is necessary for the accurate segregation of chromosomes. Failure to form crossovers can have serious consequences and may lead to chromosomal imbalance. Dmc1, a meiosis-specific paralog of Rad51, mediates the pairing of homologous chromosomes. Tid1, a Rad54 paralog, although not meiosis-specific, interacts with Dmc1 and promotes crossover formation between homologs. In this study, we show that purified Dmc1 and Tid1 interact physically and functionally. Dmc1 forms stable nucleoprotein filaments that can mediate DNA strand invasion. Tid1 stimulates Dmc1-mediated formation of joint molecules. Under conditions optimal for Dmc1 reactions, Rad51 is specifically stimulated by Rad54, establishing that Dmc1-Tid1 and Rad51-Rad54 function as specific pairs. Physical interaction studies show that specificity in function is not dictated by direct interactions between the proteins. Our data are consistent with the hypothesis that Rad51-Rad54 function together to promote intersister DNA strand exchange, whereas Dmc1-Tid1 tilt the bias toward interhomolog DNA strand exchange.
Resumo:
BACKGROUND AND AIMS: The genus Olea (Oleaceae) includes approx. 40 taxa of evergreen shrubs and trees classified in three subgenera, Olea, Paniculatae and Tetrapilus, the first of which has two sections (Olea and Ligustroides). Olive trees (the O. europaea complex) have been the subject of intensive research, whereas little is known about the phylogenetic relationships among the other species. To clarify the biogeographical history of this group, a molecular analysis of Olea and related genera of Oleaceae is thus necessary. METHODS: A phylogeny was built of Olea and related genera based on sequences of the nuclear ribosomal internal transcribed spacer-1 and four plastid regions. Lineage divergence and the evolution of abaxial peltate scales, the latter character linked to drought adaptation, were dated using a Bayesian method. KEY RESULTS: Olea is polyphyletic, with O. ambrensis and subgenus Tetrapilus not sharing a most recent common ancestor with the main Olea clade. Partial incongruence between nuclear and plastid phylogenetic reconstructions suggests a reticulation process in the evolution of subgenus Olea. Estimates of divergence times for major groups of Olea during the Tertiary were obtained. CONCLUSIONS: This study indicates the necessity of revising current taxonomic boundaries in Olea. The results also suggest that main lines of evolution were promoted by major Tertiary climatic shifts: (1) the split between subgenera Olea and Paniculatae appears to have taken place at the Miocene-Oligocene boundary; (2) the separation of sections Ligustroides and Olea may have occurred during the Early Miocene following the Mi-1 glaciation; and (3) the diversification within these sections (and the origin of dense abaxial indumentum in section Olea) was concomitant with the aridification of Africa in the Late Miocene.