991 resultados para thermogravimetry (TG)
Resumo:
TNF is well characterized as a mediator of inflammatory responses. TNF also facilitates organization of secondary lymphoid organs, particularly B cell follicles and germinal centers, a hallmark of T-dependent Ab responses. TNF also mediates defense against tumors. We examined the role of TNF in the development of inflammatory autoimmune disorders resembling systemic lupus erythematosus and Sjögren's syndrome induced by excess B cell-activating factor belonging to the TNF family (BAFF), by generating BAFF-transgenic (Tg) mice lacking TNF. TNF(-/-) BAFF-Tg mice resembled TNF(-/-) mice, in that they lacked B cell follicles, follicular dendritic cells, and germinal centers, and have impaired responses to T-dependent Ags. Nevertheless, TNF(-/-) BAFF-Tg mice developed autoimmune disorders similar to that of BAFF-Tg mice. Disease in TNF(-/-) BAFF-Tg mice correlates with the expansion of transitional type 2 and marginal zone B cell populations and enhanced T-independent immune responses. TNF deficiency in BAFF-Tg mice also led to a surprisingly high incidence of B cell lymphomas (>35%), which most likely resulted from the combined effects of BAFF promotion of neoplastic B cell survival, coupled with lack of protective antitumor defense by TNF. Thus, TNF appears to be dispensable for BAFF-mediated autoimmune disorders and may, in fact, counter any proneoplastic effects of high levels of BAFF in diseases such as Sjögren's syndrome, systemic lupus erythematosus, and rheumatoid arthritis.
Resumo:
We have investigated if changes in hepatic lipid metabolism produced by old age are related to changes in liver peroxisome proliferator-activated receptor alpha (PPARalpha). Our results indicate that 18-month-old rats showed a marked decrease in the expression and activity of liver PPARalpha, as shown by significant reductions in PPARalpha mRNA, protein and binding activity, resulting in a reduction in the relative mRNA levels of PPARalpha target genes, such as liver-carnitine-palmitoyl transferase-I (CPT-I) and mitochondrial medium-chain acyl-CoA dehydrogenase (MCAD). Further, in accordance with a liver PPARalpha deficiency in old rats, treatment of old animals with a therapeutic dose of gemfibrozil (GFB) (3mg/kg per day, 21 days) was ineffective in reducing plasma triglyceride concentrations (TG), despite attaining a 50% reduction in TG when GFB was administered to young animals at the same dose and length of treatment. We hypothesize that the decrease in hepatic PPARalpha can be related to a state of leptin resistance present in old animals.
Resumo:
The caspase 8 inhibitor c-FLIP(L) can act in vitro as a molecular switch between cell death and growth signals transmitted by the death receptor Fas (CD95). To elucidate its function in vivo, transgenic mice were generated that overexpress c-FLIP(L) in the T-cell compartment (c-FLIP(L) Tg mice). As anticipated, FasL-induced apoptosis was inhibited in T cells from the c-FLIP(L) Tg mice. In contrast, activation-induced cell death of T cells in c-FLIP(L) Tg mice was unaffected, suggesting that this deletion process can proceed in the absence of active caspase 8. Accordingly, c-FLIP(L) Tg mice differed from Fas-deficient mice by showing no accumulation of B220(+) CD4(-) CD8(-) T cells. However, stimulation of T lymphocytes with suboptimal doses of anti-CD3 or antigen revealed increased proliferative responses in T cells from c-FLIP(L) Tg mice. Thus, a major role of c-FLIP(L) in vivo is the modulation of T-cell proliferation by decreasing the T-cell receptor signaling threshold.
Resumo:
PURPOSE: Hypertriglyceridemia (hyperTG) is common among intensive care unit (ICU) patients, but knowledge about hyperTG risk factors is scarce. The present study aims to identify risk factors favoring its development in patients requiring prolonged ICU treatment. METHODS: Prospective observational study in the medicosurgical ICU of a university teaching hospital. All consecutive patients staying ≥4 days were enrolled. Potential risk factors were recorded: pathology, energy intake, amount and type of nutritional lipids, intake of propofol, glucose intake, laboratory parameters, and drugs. Triglyceride (TG) levels were assessed three times weekly. Statistics was based on two-way analysis of variance (ANOVA) and linear regression with potential risk factors. RESULTS: Out of 1,301 consecutive admissions, 220 patients were eligible, of whom 99 (45 %) presented hyperTG (triglycerides >2 mmol/L). HyperTG patients were younger, heavier, with more brain injury and multiple trauma. Intake of propofol (mg/kg/h) and lipids' propofol had the highest correlation with plasma TG (r (2) = 0.28 and 0.26, respectively, both p < 0.001). Infection and inflammation were associated with development of hyperTG [C-reactive protein (CRP), r (2) = 0.19, p = 0.004]. No strong association could be found with nutritional lipids or other risk factors. Outcome was similar in normo- and hyperTG patients. CONCLUSIONS: HyperTG is frequent in the ICU but is not associated with adverse outcome. Propofol and accompanying lipid emulsion are the strongest risk factors. Our results suggest that plasma TG should be monitored at least twice weekly in patients on propofol. The clinical consequences of propofol-related hyperTG should be investigated in further studies.
Resumo:
T-cell negative selection, a process by which intrathymic immunological tolerance is induced, involves the apoptosis-mediated clonal deletion of potentially autoreactive T cells. Although different experimental approaches suggest that this process is triggered as the result of activation-mediated cell death, the signal transduction pathways underlying this process is not fully understood. In the present report we have used an in vitro system to analyze the cell activation and proliferation requirements for the deletion of viral superantigen (SAg)-reactive Vbeta8.1 T-cell receptor (TCR) transgenic (TG) thymocytes. Our results indicate that in vitro negative selection of viral SAg-reactive CD4+ CD8+ thymocytes is dependent on thymocyte activation but does not require the proliferation of the negatively signaled thymocytes.
Resumo:
Fructose is mainly consumed with added sugars (sucrose and high fructose corn syrup), and represents up to 10% of total energy intake in the US and in several European countries. This hexose is essentially metabolized in splanchnic tissues, where it is converted into glucose, glycogen, lactate, and, to a minor extent, fatty acids. In animal models, high fructose diets cause the development of obesity, insulin resistance, diabetes mellitus, and dyslipidemia. Ectopic lipid deposition in the liver is an early occurrence upon fructose exposure, and is tightly linked to hepatic insulin resistance. In humans, there is strong evidence, based on several intervention trials, that fructose overfeeding increases fasting and postprandial plasma triglyceride concentrations, which are related to stimulation of hepatic de novo lipogenesis and VLDL-TG secretion, together with decreased VLDL-TG clearance. However, in contrast to animal models, fructose intakes as high as 200 g/day in humans only modestly decreases hepatic insulin sensitivity, and has no effect on no whole body (muscle) insulin sensitivity. A possible explanation may be that insulin resistance and dysglycemia develop mostly in presence of sustained fructose exposures associated with changes in body composition. Such effects are observed with high daily fructose intakes, and there is no solid evidence that fructose, when consumed in moderate amounts, has deleterious effects. There is only limited information regarding the effects of fructose on intrahepatic lipid concentrations. In animal models, high fructose diets clearly stimulate hepatic de novo lipogenesis and cause hepatic steatosis. In addition, some observations suggest that fructose may trigger hepatic inflammation and stimulate the development of hepatic fibrosis. This raises the possibility that fructose may promote the progression of non-alcoholic fatty liver disease to its more severe forms, i.e. non-alcoholic steatohepatitis and cirrhosis. In humans, a short-term fructose overfeeding stimulates de novo lipogenesis and significantly increases intrahepatic fat concentration, without however reaching the proportion encountered in non-alcoholic fatty liver diseases. Whether consumption of lower amounts of fructose over prolonged periods may contribute to the pathogenesis of NAFLD has not been convincingly documented in epidemiological studies and remains to be further assessed.
Resumo:
SUMMARY :Non-alcoholic fatty liver disease (NAFLD) is characterized by an elevated intra- hepatocellular lipid (IHCL) concentration (> 5%). The incidence of NAFLD is frequently increased in obese patients, and is considered to be the hepatic component of the metabolic syndrome. The metabolic syndrome, also characterized by visceral obesity, altered glucose homeostasis, insulin resistance, dyslipidemia, and high blood pressure, represents actually a major public health burden. Both dietary factors and low physical activity are involved in the development of the metabolic syndrome. ln animals and healthy humans, high-fat or high-fructose diets lead to the development of several features of the metabolic syndrome including increased intrahepatic lipids and insulin resistance. ln contrast the effects of dietary protein are less well known, but an increase in protein intake has been suggested to exert beneficial effects by promoting weight loss and improving glucose homeostasis in insulin-resistant patients. Increased postprandial thermogenesis and enhanced satiety after protein ingestion may be both involved. The effects of dietary protein on hepatic lipids have been poorly investigated in humans, but preliminary studies in rodents have shown a reduction of hepatic lipids in carbohydrate fed rats and in obese rats. ln this context this work aimed at investigating the metabolic effects of dietary protein intake on hepatic lipid metabolism and glucose homeostasis in humans. The modulation by dietary proteins of exogenous lipid oxidation, net lipid oxidation, hepatic beta-oxidation, triglycerides concentrations, whole-body energy expenditure and glucose tolerance was assessed in the fasting state and in postprandial states. Measurements of IHCL were performed to quantify the amount of triglycerides in the liver. ln an attempt to cover all these metabolic aspects under different point of views, these questions were addressed by three protocols involving various feeding conditions. Study I addressed the effects of a 4-day hypercaloric high-fat high-protein diet on the accumulation of fat in the liver (IHCL) and on insulin sensitivity. Our findings indicated that a high protein intake significantly prevents intrahepatic fat deposition induced by a short- term hypercaloric high-fat diet, adverse effects of which are presumably modulated at the liver level.These encouraging results led us to conduct the second study (Study ll), as we were also interested in a more clinical approach to protein administration and especially if increased protein intakes might be of benefit for obese patients. Therefore the effects of one-month whey protein supplementation on IHCL, insulin sensitivity, lipid metabolism, glucose tolerance and renal function were assessed in obese women. Results showed that whey protein supplementation reduces hepatic steatosis and improves the plasma lipid profile in obese patients, without adverse effects on glucose tolerance or creatinine clearance. However since patients were fed ud-libitum, it remains possible that spontaneous carbohydrate and fat intakes were reduced due to the satiating effects of protein. The third study (Study lll) was designed in an attempt to deepen our comprehension about the mechanisms involved in the modulation of IHCL. We hypothesized that protein improved lipid metabolism and, therefore, we evaluated the effects of a high protein meal on postprandial lipid metabolism and glucose homeostasis after 4-day on a control or a protein diet. Our results did not sustain the hypothesis of an increased postprandial net lipid oxidation, hepatic beta oxidation and exogenous lipid oxidation. Four days on a high-protein diet rather decreased exogenous fat oxidation and enhanced postprandial triglyceride concentrations, by impairing probably chylomicron-TG clearance. Altogether the results of these three studies suggest a beneficial effect of protein intake on the reduction in lHCL, and clearly show that supplementation of proteins do not reduce IHCL by stimulating lipid metabolism, e.g. whole body fat oxidation, hepatic beta oxidation, or exogenous fat oxidation. The question of the effects of high-protein intakes on hepatic lipid metabolism is still open and will need further investigation to be elucidated. The effects of protein on increased postprandial lipemia and lipoproteins kinetics have been little investigated so far and might therefore be an interesting research question, considering the tight relationship between an elevation of plasmatic TG concentrations and the increased incidence of cardiovascular diseases.Résumé :La stéatose hépatique non alcoolique se caractérise par un taux de lipides intra-hépatiques élevé, supérieur à 5%. L'incidence de la stéatose hépatique est fortement augmentée chez les personnes obèses, ce qui mène à la définir comme étant la composante hépatique du syndrome métabolique. Ce syndrome se définit aussi par d'autres critères tels qu'obésité viscérale, altération de l'homéostasie du glucose, résistance à l'insuline, dyslipidémie et pression artérielle élevée. Le syndrome métabolique est actuellement un problème de santé publique majeur.Tant une alimentation trop riche et déséquilibrée, qu'une faible activité physique, semblent être des causes pouvant expliquer le développement de ce syndrome. Chez l'animal et le volontaire sain, des alimentations enrichies en graisses ou en sucres (fructose) favorisent le développement de facteurs associés au syndrome métabolique, notamment en augmentant le taux de lipides intra-hépatiques et en induisant le développement d'une résistance à l'insuline. Par ailleurs, les effets des protéines alimentaires sont nettement moins bien connus, mais il semblerait qu'une augmentation de l'apport en protéines soit bénéfique, favorisant la perte de poids et l'homéostasie du glucose chez des patients insulino-résistants. Une augmentation de la thermogenese postprandiale ainsi que du sentiment de satiété pourraient en être à l'origine.Les effets des protéines sur les lipides intra-hépatiques chez l'homme demeurent inconnus à ce jour, cependant des études préliminaires chez les rongeurs tendent à démontrer une diminution des lipides intra hépatiques chez des rats nourris avec une alimentation riche en sucres ou chez des rats obèses.Dans un tel contexte de recherche, ce travail s'est intéressé à l'étude des effets métaboliques des protéines alimentaires sur le métabolisme lipidique du foie et sur l'homéostasie du glucose. Ce travail propose d'évaluer l'effet des protéines alimentaires sur différentes voies métaboliques impliquant graisses et sucres, en ciblant d'une part les voies de l'oxydation des graisses exogènes, de la beta-oxydation hépatique et de l'oxydation nette des lipides, et d'autre part la dépense énergétique globale et l'évolution des concentrations sanguines des triglycérides, à jeun et en régime postprandial. Des mesures des lipides intra-hépatiques ont aussi été effectuées pour permettre la quantification des graisses déposées dans le foie.Dans le but de couvrir l'ensemble de ces aspects métaboliques sous différents angles de recherche, trois protocoles, impliquant des conditions alimentaires différentes, ont été entrepris pour tenter de répondre à ces questions. La première étude (Etude I) s'est intéressée aux effets d'u.ne suralimentation de 4 jours enrichie en graisses et protéines sur la sensibilité à l'insuline et sur l'accumulation de graisses intra-hépatiques. Les résultats ont démontré que l'apport en protéines prévient l'accumulation de graisses intra-hépatiques induite par une suralimentation riche en graisses de courte durée ainsi que ses effets délétères probablement par le biais de mécanismes agissant au niveau du foie. Ces résultats encourageants nous ont conduits à entreprendre une seconde étude (Etude ll) qui s'intéressait à l'implication clinique et aux bénéfices que pouvait avoir une supplémentation en protéines sur les graisses hépatiques de patients obèses. Ainsi nous avons évalué pendant un mois de supplémentation l'effet de protéines de lactosérum sur le taux de graisses intrahépatiques, la sensibilité à l'insuline, la tolérance au glucose, le métabolisme des graisses et la fonction rénale chez des femmes obèses. Les résultats ont été encourageants; la supplémentation en lactosérum améliore la stéatose hépatique, le profil lipidique des patientes obèses sans pour autant altérer la tolérance au glucose ou la clairance de la créatinine. L'effet satiétogene des protéines pourrait aussi avoir contribué à renforcer ces effets. La troisième étude s'est intéressée aux mécanismes qui sous-tendent les effets bénéfiques des protéines observés dans les 2 études précédentes. Nous avons supposé que les protéines devaient favoriser le métabolisme des graisses. Par conséquent, nous avons cherché a évaluer les effets d'un repas riche en protéines sur la lipémie postprandiale et l'homéostasie glucidique après 4 jours d'alimentation contrôlée soit isocalorique et équilibrée, soit hypercalorique enrichie en protéines. Les résultats obtenus n'ont pas vérifié l'hypothèse initiale ; ni une augmentation de l'oxydation nette des lipides, ni celle d'une augmentation de la béta-oxydation hépatique ou de l'oxydation d'un apport exogène de graisses n'a pu étre observée. A contrario, il semblerait même plutôt que 4 jours d'a]irnentation hyperprotéinée inhibent le métabolisme des graisses et augmente les concentrations sanguines de triglycérides, probablement par le biais d'une clairance de chylornicrons altérée. Globalement, les résultats de ces trois études nous permettent d'attester que les protéines exercent un effet bénéfique en prévenant le dépot de graisses intra-hépatiques et montrent que cet effet ne peut être attribué à une stimulation du métabolisme des lipides via l'augmentation des oxydations des graisses soit totales, hépatiques, ou exogènes. La question demeure en suspens à ce jour et nécessite de diriger la recherche vers d'autres voies d'exploration. Les effets des protéines sur la lipémie postprandiale et sur le cinétique des lipoprotéines n'a que peu été traitée à ce jour. Cette question me paraît néanmoins importante, sachant que des concentrations sanguines élevées de triglycérides sont étroitement corrélées à une incidence augmentée de facteurs de risque cardiovasculaire.
Resumo:
We conducted a genome-wide scan using variance components linkage analysis to localize quantitative-trait loci (QTLs) influencing triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol, and total cholesterol (TC) levels in 3,071 subjects from 459 families with atherogenic dyslipidemia. The most significant evidence for linkage to TG levels was found in a subset of Turkish families at 11q22 [logarithm of the odds ratio (LOD)=3.34] and at 17q12 (LOD=3.44). We performed sequential oligogenic linkage analysis to examine whether multiple QTLs jointly influence TG levels in the Turkish families. These analyses revealed loci at 20q13 that showed strong epistatic effects with 11q22 (conditional LOD=3.15) and at 7q36 that showed strong epistatic effects with 17q12 (conditional LOD=3.21). We also found linkage on the 8p21 region for TG in the entire group of families (LOD=3.08). For HDL-C levels, evidence of linkage was identified on chromosome 15 in the Turkish families (LOD=3.05) and on chromosome 5 in the entire group of families (LOD=2.83). Linkage to QTLs for TC was found at 8p23 in the entire group of families (LOD=4.05) and at 5q13 in a subset of Turkish and Mediterranean families (LOD=3.72). These QTLs provide important clues for the further investigation of genes responsible for these complex lipid phenotypes. These data also indicate that a large proportion of the variance of TG levels in the Turkish population is explained by the interaction of multiple genetic loci.
Resumo:
Cardiac hypertrophy is associated with alterations in cardiomyocyte excitation-contraction coupling (ECC) and Ca(2+) handling. Chronic elevation of plasma angiotensin II (Ang II) is a major determinant in the pathogenesis of cardiac hypertrophy and congestive heart failure. However, the molecular mechanisms by which the direct actions of Ang II on cardiomyocytes contribute to ECC remodeling are not precisely known. This question was addressed using cardiac myocytes isolated from transgenic (TG1306/1R [TG]) mice exhibiting cardiac specific overexpression of angiotensinogen, which develop Ang II-mediated cardiac hypertrophy in the absence of hemodynamic overload. Electrophysiological techniques, photolysis of caged Ca(2+) and confocal Ca(2+) imaging were used to examine ECC remodeling at early ( approximately 20 weeks of age) and late ( approximately 60 weeks of age) time points during the development of cardiac dysfunction. In young TG mice, increased cardiac Ang II levels induced a hypertrophic response in cardiomyocyte, which was accompanied by an adaptive change of Ca(2+) signaling, specifically an upregulation of the Na(+)/Ca(2+) exchanger-mediated Ca(2+) transport. In contrast, maladaptation was evident in older TG mice, as suggested by reduced sarcoplasmic reticulum Ca(2+) content resulting from a shift in the ratio of plasmalemmal Ca(2+) removal and sarcoplasmic reticulum Ca(2+) uptake. This was associated with a conserved ECC gain, consistent with a state of hypersensitivity in Ca(2+)-induced Ca(2+) release. Together, our data suggest that chronic elevation of cardiac Ang II levels significantly alters cardiomyocyte ECC in the long term, and thereby contractility, independently of hemodynamic overload and arterial hypertension.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
BACKGROUND & AIMS: It has been reported that a high protein diet improves insulin sensitivity and reduces ectopic lipids in animals and humans with the metabolic syndrome. We therefore tested the hypothesis that a high dietary protein content may stimulate whole body lipid oxidation and alter post-prandial triglyceride (TG) after fructose ingestion. METHODS: The post-prandial metabolism of 8 young males was studied after two 6-day periods of hyper-energetic, high fructose diet (HiFruD), and after two 6-day periods of hyper-energetic high fructose high protein diet (HiFruHiProD). The order with which these periods were applied was randomized. At the end of each period, either a low protein, (13)C fructose test meal (Fru meal) or a high protein, (13)C fructose test meal (HiPro Fru meal) was administered. This resulted in the monitoring of metabolic parameters at 4 occasions in random order: a) with Fru meal ingested after HiFruD, b) with HiPro Fru meal ingested after HiFruD, c) with Fru meal ingested after HiFruHiProD or d) with HiPro Fru meal ingested after HiFruHiProD. On each occasion, post-prandial TG concentrations were monitored, energy expenditure and substrate metabolism were measured by indirect calorimetry, and fructose-induced gluconeogenesis was evaluated by measuring plasma (13)C-labeled glucose. RESULTS: TG responses to fructose ingestion were significantly higher after a hyper-energetic HiFruHiProD and after HiPro Fru meals than after a Fru meal ingested after a hyper-energetic HiFruD. Compared to low protein meals, high protein meals increased post-prandial energy expenditure, inhibited post-prandial lipid oxidation, and enhanced fructose-induced gluconeogenesis. These effects were similar with HiFruD and HiFruHiProD. CONCLUSIONS: Dietary proteins did not increase lipid oxidation and increased fructose-induced post-prandial TG in healthy humans fed an hyper-energetic, high fructose diet.
Resumo:
High systemic levels of IP-10 at onset of combination therapy for chronic hepatitis C mirror intrahepatic mRNA levels and predict a slower first phase decline in HCV RNA as well as poor outcome. Recently several genome wide association studies have revealed that single nucleotide polymorphisms (SNPs) on chromosome19 within proximity of IL28B predict spontaneous clearance of HCV infection and as therapeutic outcome among patients infected with HCV genotype 1, with three such SNPs being highly predictive: rs12979860, rs12980275, and rs8099917. In the present study, we correlated genetic variations in these SNPs from 253 Caucasian patients with pretreatment plasma levels of IP-10 and HCV RNA throughout therapy within a phase III treatment trial (HCV-DITTO). The favorable genetic variations in all three SNPs (CC, AA, and TT respectively) was significantly associated with lower baseline IP-10 (CC vs. CT/TT at rs12979860: median 189 vs. 258 pg/mL, P=0.02, AA vs. AG/GG at rs12980275: median 189 vs. 258 pg/mL, P=0.01, TT vs. TG/GG at rs8099917: median 224 vs. 288 pg/mL, P=0.04), were significantly less common among HCV genotype 1 infected patients than genotype 2/3 (P<0.0001, P<0.0001, and P=0.01 respectively) and had significantly higher baseline viral load than carriers of the SNP genotypes (6.3 vs. 5.9 log 10 IU/mL, P=0.0012, 6.3 vs. 6.0 log 10 IU/mL, P=0.026, and 6.3 vs. 5.8 log 10 IU/mL, P=0.0003 respectively). Among HCV genotype 1 infected homozygous or heterogeneous carriers of the favorable C, A, and T genotypes, lower baseline IP-10 was significantly associated with greater decline in HCV-RNA day 0-4, which translated into increased rates of achieving SVR among homozygous patients with baseline IP-10 below 150 pg/mL (85%, 75%, and 75% respectively). In a multivariate analysis among genotype 1 infected patients, both baseline IP-10 and the SNPs were significant independent predictors of SVR. Conclusion: Baseline plasma IP-10 is significantly associated with IL28B variations, and augments the predictiveness of the first phase decline in HCV RNA and final treatment outcome.
Resumo:
Immunoscintigraphy (IS) consists of in vivo body structure imaging using a specific labelled antibody to an antigen concentrated in the structure under study. Technically, the image contrast is better when IS is performed with a computerized emission tomography system. High concentrations of carcinoembryonic antigen (CEA) have been reported in medullary thyroid carcinoma and thyroglobulin (Tg) is a marker for differentiated thyroid carcinoma. We used injections of 131-I labelled monoclonal antibodies to CEA and Tg to detect thyroid tumours. A feasibility trial using anti-CEA antibodies gave very encouraging results. However, only tumours larger than 10 cm3 could be detected. Contradictory results were obtained using anti-Tg antibodies but this data must be considered as preliminary. Various means of improving the method and the concept of accessibility of the antigen to the antibody in vivo are discussed. This study shows IS to be a promising experimental technique. Further studies are required to define its clinical indications before it can be advocated for routine use.
Resumo:
Transplant glomerulopathy (TG) has received much attention in recent years as a symptom of chronic humoral rejection; however, many cases lack C4d deposition and/or circulating donor-specific antibodies (DSAs). To determine the contribution of other causes, we studied 209 consecutive renal allograft indication biopsies for chronic allograft dysfunction, of which 25 met the pathological criteria of TG. Three partially overlapping etiologies accounted for 21 (84%) cases: C4d-positive (48%), hepatitis C-positive (36%), and thrombotic microangiopathy (TMA)-positive (32%) TG. The majority of patients with confirmed TMA were also hepatitis C positive, and the majority of hepatitis C-positive patients had TMA. DSAs were significantly associated with C4d-positive but not with hepatitis C-positive TG. The prevalence of hepatitis C was significantly higher in the TG group than in 29 control patients. Within the TG cohort, those who were hepatitis C-positive developed allograft failure significantly earlier than hepatitis C-negative patients. Thus, TG is not a specific diagnosis but a pattern of pathological injury involving three major overlapping pathways. It is important to distinguish these mechanisms, as they may have different prognostic and therapeutic implications.
Resumo:
O objetivo deste trabalho foi avaliar a viscosidade, a quantidade de água não congelada (w nc) e a temperatura de transição vítrea da fração maximamente crioconcentrada (Tg') de misturas para sherbet, e a incorporação de ar (IAr) dos sherbets, com diferentes concentrações de goma guar (0,2% a 0,5%) e polpa de mangaba (21,1%, 25,8% e 28,6%). A viscosidade aparente variou de 85,8 a 286,1 cP, aumentando com as concentrações de goma guar e mangaba. As análises térmicas com calorímetro diferencial de varredura mostraram que a w nc variou entre 12% e 20%, diminuindo com o aumento da concentração de polpa. A Tg' variou de -57,65ºC a -53,45ºC e não apresentou diferença entre as amostras. A IAr foi de 20,01% a 40,59%. Sherbets com a mesma concentração de polpa apresentaram valores diferentes desta variável, mas uma relação entre o aumento da quantidade de goma guar e maior IAr foi observada somente para os sherbets com 25,8% de polpa. O estabilizante interfere na viscosidade da mistura e IAr, e a concentração de polpa influencia as propriedades térmicas. O aumento de IAr proporciona melhor maciez ao produto. Maior quantidade de polpa diminui a w nc, assim o produto terá menos água disponível para migrar e formar cristais de gelo maiores durante as oscilações na temperatura, diminuindo a qualidade do produto.