Paul and death : a study in psychological coping

The present investigation looks into the attitudes toward death in Paul’s authentic letters, and puts them in relation to modern theories of psychological coping. Drawing on psychologically-oriented hermeneutic theory, and theories about psychological coping in particular, I argue that each case of psychological coping must be understood in its historical situation as strategies emanating from a specific person’s subjective appraisal (cf. Pargament, Lazarus and Folkman). Paul’s letters frequently refer to persecution and violent death. To aid in psychological coping is often integral to the purpose of the letters, which makes the perspective of psychological coping akin to their genre. In the course of a tentatively assumed chronological order of 1 Thessalonians, Galatians, 1 Corinthians, 2 Corinthians, Romans, Philippians, and Philemon, Paul moves from the perception of Jesus dying for the faithful to the understanding of dying with Jesus. His coping strategies concerning death are gradually transformed from conservative and deferring coping styles, to a more self-directing coping style, to collaborative and transformative coping styles, and finally to a new sense of deferring coping style in prison. The last case of deferring coping carries the traits of generosity and flexibility even in the face of death, which is in contrast to his previous letters. Through his correspondence, we see Paul’s attitude toward death transformed from denial to reaction, to processing, to acceptance (cf. Lindemann, Kübler-Ross, Bowlby, Parkes, among others). His strategies also shift in accordance with these understandings. Denial is accompanied by diversion, threat by aggression, processing by rumination, and acceptance by joy. The study shows the hermeneutic benefits of reading Paul’s letters as the rhetorically framed expressions of a person in a particular historical situation. The letters open small windows through which we can glimpse the coping process of a person of antiquity. In adopting the method of psychological exegesis, the study shows that the variety of attitudes toward death in Paul’s letters makes sense from the perspective of psychological coping. The psychological aspect of these letters is an underexamined richness that can extend into areas of contemporary individual and group identity, and from there to public policy and ethics.

Semantic and fuzzy modelling for human behaviour recognition in smart spaces : a case study on ambient assisted living.

Human activity recognition in everyday environments is a critical, but challenging task in Ambient Intelligence applications to achieve proper Ambient Assisted Living, and key challenges still remain to be dealt with to realize robust methods. One of the major limitations of the Ambient Intelligence systems today is the lack of semantic models of those activities on the environment, so that the system can recognize the speci c activity being performed by the user(s) and act accordingly. In this context, this thesis addresses the general problem of knowledge representation in Smart Spaces. The main objective is to develop knowledge-based models, equipped with semantics to learn, infer and monitor human behaviours in Smart Spaces. Moreover, it is easy to recognize that some aspects of this problem have a high degree of uncertainty, and therefore, the developed models must be equipped with mechanisms to manage this type of information. A fuzzy ontology and a semantic hybrid system are presented to allow modelling and recognition of a set of complex real-life scenarios where vagueness and uncertainty are inherent to the human nature of the users that perform it. The handling of uncertain, incomplete and vague data (i.e., missing sensor readings and activity execution variations, since human behaviour is non-deterministic) is approached for the rst time through a fuzzy ontology validated on real-time settings within a hybrid data-driven and knowledgebased architecture. The semantics of activities, sub-activities and real-time object interaction are taken into consideration. The proposed framework consists of two main modules: the low-level sub-activity recognizer and the high-level activity recognizer. The rst module detects sub-activities (i.e., actions or basic activities) that take input data directly from a depth sensor (Kinect). The main contribution of this thesis tackles the second component of the hybrid system, which lays on top of the previous one, in a superior level of abstraction, and acquires the input data from the rst module's output, and executes ontological inference to provide users, activities and their in uence in the environment, with semantics. This component is thus knowledge-based, and a fuzzy ontology was designed to model the high-level activities. Since activity recognition requires context-awareness and the ability to discriminate among activities in di erent environments, the semantic framework allows for modelling common-sense knowledge in the form of a rule-based system that supports expressions close to natural language in the form of fuzzy linguistic labels. The framework advantages have been evaluated with a challenging and new public dataset, CAD-120, achieving an accuracy of 90.1% and 91.1% respectively for low and high-level activities. This entails an improvement over both, entirely data-driven approaches, and merely ontology-based approaches. As an added value, for the system to be su ciently simple and exible to be managed by non-expert users, and thus, facilitate the transfer of research to industry, a development framework composed by a programming toolbox, a hybrid crisp and fuzzy architecture, and graphical models to represent and con gure human behaviour in Smart Spaces, were developed in order to provide the framework with more usability in the nal application. As a result, human behaviour recognition can help assisting people with special needs such as in healthcare, independent elderly living, in remote rehabilitation monitoring, industrial process guideline control, and many other cases. This thesis shows use cases in these areas.

Down-regulation of the cardiac sarcoplasmic reticulum ryanodine channel in severely food-restricted rats

We have shown that myocardial dysfunction induced by food restriction is related to calcium handling. Although cardiac function is depressed in food-restricted animals, there is limited information about the molecular mechanisms that lead to this abnormality. The present study evaluated the effects of food restriction on calcium cycling, focusing on sarcoplasmic Ca2+-ATPase (SERCA2), phospholamban (PLB), and ryanodine channel (RYR2) mRNA expressions in rat myocardium. Male Wistar-Kyoto rats, 60 days old, were submitted to ad libitum feeding (control rats) or 50% diet restriction for 90 days. The levels of left ventricle SERCA2, PLB, and RYR2 were measured using semi-quantitative RT-PCR. Body and ventricular weights were reduced in 50% food-restricted animals. RYR2 mRNA was significantly decreased in the left ventricle of the food-restricted group (control = 5.92 ± 0.48 vs food-restricted group = 4.84 ± 0.33, P < 0.01). The levels of SERCA2 and PLB mRNA were similar between groups (control = 8.38 ± 0.44 vs food-restricted group = 7.96 ± 0.45, and control = 1.52 ± 0.06 vs food-restricted group = 1.53 ± 0.10, respectively). Down-regulation of RYR2 mRNA expressions suggests that chronic food restriction promotes abnormalities in sarcoplasmic reticulum Ca2+ release.

Serotonergic modulation of face-emotion recognition

Facial expressions of basic emotions have been widely used to investigate the neural substrates of emotion processing, but little is known about the exact meaning of subjective changes provoked by perceiving facial expressions. Our assumption was that fearful faces would be related to the processing of potential threats, whereas angry faces would be related to the processing of proximal threats. Experimental studies have suggested that serotonin modulates the brain processes underlying defensive responses to environmental threats, facilitating risk assessment behavior elicited by potential threats and inhibiting fight or flight responses to proximal threats. In order to test these predictions about the relationship between fearful and angry faces and defensive behaviors, we carried out a review of the literature about the effects of pharmacological probes that affect 5-HT-mediated neurotransmission on the perception of emotional faces. The hypothesis that angry faces would be processed as a proximal threat and that, as a consequence, their recognition would be impaired by an increase in 5-HT function was not supported by the results reviewed. In contrast, most of the studies that evaluated the behavioral effects of serotonin challenges showed that increased 5-HT neurotransmission facilitates the recognition of fearful faces, whereas its decrease impairs the same performance. These results agree with the hypothesis that fearful faces are processed as potential threats and that 5-HT enhances this brain processing.

High expression of the circadian gene mPer2 diminishes the radiosensitivity of NIH 3T3 cells

Period2 is a core circadian gene, which not only maintains the circadian rhythm of cells but also regulates some organic functions. We investigated the effects of mPeriod2 (mPer2) expression on radiosensitivity in normal mouse cells exposed to 60Co-γ-rays. NIH 3T3 cells were treated with 12-O-tetradecanoylphorbol-13-acetate (TPA) to induce endogenous mPer2 expression or transfected with pcDNA3.1(+)-mPer2 and irradiated with 60Co-γ-rays, and then analyzed by several methods such as flow cytometry, colony formation assay, RT-PCR, and immunohistochemistry. Flow cytometry and colony formation assay revealed that irradiated NIH 3T3 cells expressing high levels of mPer2 showed a lower death rate (TPA: 24 h 4.3% vs 12 h 6.8% and control 9.4%; transfection: pcDNA3.1-mPer2 3.7% vs pcDNA3.1 11.3% and control 8.2%), more proliferation and clonogenic survival (TPA: 121.7 ± 6.51 vs 66.0 ± 3.51 and 67.7 ± 7.37; transfection: 121.7 ± 6.50 vs 65.3 ± 3.51 and 69.0 ± 4.58) both when treated with TPA and transfected with mPer2. RT-PCR analysis showed an increased expression of bax, bcl-2, p53, c-myc, mre11, and nbs1, and an increased proportionality of bcl-2/bax in the irradiated cells at peak mPer2 expression compared with cells at trough mPer2 expression and control cells. However, no significant difference in rad50 expression was observed among the three groups of cells. Immunohistochemistry also showed increased protein levels of P53, BAX and proliferating cell nuclear antigen in irradiated cells with peak mPer2 levels. Thus, high expression of the circadian gene mPer2 may reduce the radiosensitivity of NIH 3T3 cells. For this effect, mPer2 may directly or indirectly regulate the expressions of cell proliferation- and apoptosis-related genes and DNA repair-related genes.

A DNA enzyme targeting Egr-1 inhibits rat vascular smooth muscle cell proliferation by down-regulation of cyclin D1 and TGF-β1

We have demonstrated that a synthetic DNA enzyme targeting early growth response factor-1 (Egr-1) can inhibit neointimal hyperplasia following vascular injury. However, the detailed mechanism of this inhibition is not known. Thus, the objective of the present study was to further investigate potential inhibitory mechanisms. Catalytic DNA (ED5) and scrambled control DNA enzyme (ED5SCR) were synthesized and transfected into primary cultures of rat vascular smooth muscle cells (VSMCs). VSMC proliferation and DNA synthesis were analyzed by the MTT method and BrdU staining, respectively. Egr-1, TGF-β1, p53, p21, Bax, and cyclin D1 expression was detected by RT-PCR and Western blot. Apoptosis and cell cycle assays were performed by FACS. Green fluorescence could be seen localized in the cytoplasm of 70.6 ± 1.52 and 72 ± 2.73% VSMCs 24 h after transfection of FITC-labeled ED5 and ED5SCR, respectively. We found that transfection with ED5 significantly inhibited cultured VSMC proliferation in vitro after 24, 48, and 72 h of serum stimulation, and also effectively decreased the uptake of BrdU by VSMC. ED5 specifically reduced serum-induced Egr-1 expression in VSMCs, further down-regulated the expression of cyclin D1 and TGF-β1, and arrested the cells at G0/G1, inhibiting entry into the S phase. FACS analysis indicated that there was no significant difference in the rate of apoptosis between ED5- and ED5SCR-transfected cells. Thus, ED5 can specifically inhibit Egr-1 expression, and probably inhibits VSMC proliferation by down-regulating the expressions of cyclin D1 and TGF-β1. However, ED5 has no effect on VSMC apoptosis.

Effect of escitalopram on the processing of emotional faces

Serotonin has been implicated in the neurobiology of depressive and anxiety disorders, but little is known about its role in the modulation of basic emotional processing. The aim of this study was to determine the effect of the selective serotonin reuptake inhibitor, escitalopram, on the perception of facial emotional expressions. Twelve healthy male volunteers completed two experimental sessions each, in a randomized, balanced order, double-blind design. A single oral dose of escitalopram (10 mg) or placebo was administered 3 h before the task. Participants were presented to a task composed of six basic emotions (anger, disgust, fear, happiness, sadness, and surprise) that were morphed between neutral and each standard emotion in 10% steps. Escitalopram facilitated the recognition of sadness and inhibited the recognition of happiness in male, but not female faces. No drug effect on subjective measures was detected. These results confirm that serotonin modulates the recognition of emotional faces, and suggest that the gender of the face can have a role in this modulation. Further studies including female volunteers are needed.

An improved strategy for evaluating the extent of chronic arterial baroreceptor denervation in conscious rats

There is no index or criterion of aortic barodenervation, nor can we differentiate among rats that have suffered chronic sham, aortic or sino-aortic denervation. The objective of this study was to develop a procedure to generate at least one quantitative, reproducible and validated index that precisely evaluates the extent of chronic arterial barodenervation performed in conscious rats. Data from 79 conscious male Wistar rats of about 65-70 days of age with diverse extents of chronic arterial barodenervation and used in previous experiments were reanalyzed. The mean arterial pressure (MAP) and the heart rate (HR) of all rats were measured systematically before (over 1 h) and after three consecutive iv bolus injections of phenylephrine (PHE) and sodium nitroprusside (SNP). Four expressions of the effectiveness of barodenervation (MAP lability, PHE ratio, SNP ratio, and SNP-PHE slope) were assessed with linear fixed models, three-level average variance, average separation among levels, outlier box plot analysis, and overlapping graphic analysis. The analysis indicated that a) neither MAP lability nor SNP-PHE slope was affected by the level of chronic sodium intake; b) even though the Box-Cox transformations of both MAP lability [transformed lability index (TLI)] and SNP-PHE slope [transformed general sensitivity index (TGSI), {((3-(ΔHRSNP-ΔHRPHE/ΔMAPSNP-ΔMAPPHE))-0.4-1)/-0.04597}] could be two promising indexes, TGSI proved to be the best index; c) TLI and TGSI were not freely interchangeable indexes for this purpose. TGSI ranges that permit differentiation between sham (10.09 to 11.46), aortic (8.40 to 9.94) and sino-aortic (7.68 to 8.24) barodenervated conscious rats were defined.

Tetramethylpyrazine potentiates arsenic trioxide activity against HL-60 cell lines

The objective of this study was to evaluate the effects of tetramethylpyrazine (TMP) in combination with arsenic trioxide (As2O3) on the proliferation and differentiation of HL-60 cells. The HL-60 cells were treated with 300 µg/mL TMP, 0.5 µM As2O3, and 300 µg/mL TMP combined with 0.5 µM As2O3, respectively. The proliferative inhibition rates were determined with MTT. Differentiation was detected by the nitroblue tetrazolium (NBT) reduction test, Wright’s staining and the distribution of CD11b and CD14. Flow cytometry was used to analyze cell cycle distribution. RT-PCR and Western blot assays were employed to detect the expressions of c-myc, p27, CDK2, and cyclin E1. Combination treatment had synergistic effects on the proliferative inhibition rates. The rates were increased gradually after the combination treatment, much higher than those treated with the corresponding concentration of As2O3 alone. The cells exhibited characteristics of mature granulocytes and a higher NBT-reducing ability, being a 2.6-fold increase in the rate of NBT-positive ratio of HL-60 cells within the As2O3 treatment versus almost a 13-fold increase in the TMP + As2O3 group. Cells treated with both TMP and As2O3 expressed far more CD11b antigens, almost 2-fold compared with the control group. Small doses of TMP potentiate As2O3-induced differentiation of HL-60 cells, possibly by regulating the expression and activity of G0/G1 phase-arresting molecules. Combination treatment of TMP with As2O3 has significant synergistic effects on the proliferative inhibition of HL-60 cells.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

ERKs and mitochondria-related pathways are essential for glycyrrhizic acid-mediated neuroprotection against glutamate-induced toxicity in differentiated PC12 cells

The present study focuses on the neuroprotective effect of glycyrrhizic acid (GA, a major compound separated from Glycyrrhiza Radix, which is a crude Chinese traditional drug) against glutamate-induced cytotoxicity in differentiated PC12 (DPC12) cells. The results showed that GA treatment improved cell viability and ameliorated abnormal glutamate-induced alterations in mitochondria in DPC12 cells. GA reversed glutamate-suppressed B-cell lymphoma 2 levels, inhibited glutamate-enhanced expressions of Bax and cleaved caspase 3, and reduced cytochrome C (Cyto C) release. Exposure to glutamate strongly inhibited phosphorylation of AKT (protein kinase B) and extracellular signal-regulated kinases (ERKs); however, GA pretreatment enhanced activation of ERKs but not AKT. The presence of PD98059 (a mitogen-activated protein/extracellular signal-regulated kinase kinase [MEK] inhibitor) but not LY294002 (a phosphoinositide 3-kinase [PI3K] inhibitor) diminished the potency of GA for improving viability of glutamate-exposed DPC12 cells. These results indicated that ERKs and mitochondria-related pathways are essential for the neuroprotective effect of GA against glutamate-induced toxicity in DPC12 cells. The present study provides experimental evidence supporting GA as a potential therapeutic agent for use in the treatment of neurodegenerative diseases.

Possible roles of COX-1 in learning and memory impairment induced by traumatic brain injury in mice

People who suffer from traumatic brain injury (TBI) often experience cognitive deficits in spatial reference and working memory. The possible roles of cyclooxygenase-1 (COX-1) in learning and memory impairment in mice with TBI are far from well known. Adult mice subjected to TBI were treated with the COX-1 selective inhibitor SC560. Performance in the open field and on the beam walk was then used to assess motor and behavioral function 1, 3, 7, 14, and 21 days following injury. Acquisition of spatial learning and memory retention was assessed using the Morris water maze on day 15 post-TBI. The expressions of COX-1, prostaglandin E2 (PGE2), interleukin (IL)-6, brain-derived neurotrophic factor (BDNF), platelet-derived growth factor BB (PDGF-BB), synapsin-I, and synaptophysin were detected in TBI mice. Administration of SC560 improved performance of beam walk tasks as well as spatial learning and memory after TBI. SC560 also reduced expressions of inflammatory markers IL-6 and PGE2, and reversed the expressions of COX-1, BDNF, PDGF-BB, synapsin-I, and synaptophysin in TBI mice. The present findings demonstrated that COX-1 might play an important role in cognitive deficits after TBI and that selective COX-1 inhibition should be further investigated as a potential therapeutic approach for TBI.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Hyaluronidases and hyaluronan synthases expression is inversely correlated with malignancy in lung/bronchial pre-neoplastic and neoplastic lesions, affecting prognosis

We collected a series of 136 lung/bronchial and 56 matched lung parenchyma tissue samples from patients who underwent lung/bronchial biopsies and presented invasive carcinoma after lung surgery. The lung/bronchial samples included basal cell hyperplasia, squamous metaplasia, moderate dysplasia, adenomatous hyperplasia, severe dysplasia, squamous cell carcinoma and adenocarcinoma. Matched lung parenchyma tissue samples included 25 squamous cell carcinomas and 31 adenocarcinomas. Immunohistochemistry was performed to analyze for the distribution of hyaluronidase (Hyal)-1 and −3, and hyaluronan synthases (HAS)-1, −2, and −3. Hyal-1 showed significantly higher expression in basal cell hyperplasia than in moderate dysplasia (P=0.01), atypical adenomatous hyperplasia (P=0.0001), or severe dysplasia (P=0.03). Lower expression of Hyal-3 was found in atypical adenomatous hyperplasia than in basal cell hyperplasia (P=0.01) or moderate dysplasia (P=0.02). HAS-2 was significantly higher in severe dysplasia (P=0.002) and in squamous metaplasia (P=0.04) compared with basal cell hyperplasia. HAS-3 was significantly expressed in basal cell hyperplasia compared with atypical adenomatous hyperplasia (P=0.05) and severe dysplasia (P=0.02). Lower expression of HAS-3 was found in severe dysplasia compared with squamous metaplasia (P=0.01) and moderate dysplasia (P=0.01). Epithelial Hyal-1 and −3 and HAS-1, −2, and −3 expressions were significantly higher in pre-neoplastic lesions than in neoplastic lesions. Comparative Cox multivariate analysis controlled by N stage and histologic tumor type showed that patients with high HAS-3 expression in pre-neoplastic cells obtained by lung/bronchial biopsy presented a significantly higher risk of death (HR=1.19; P=0.04). We concluded that localization of Hyal and HAS in lung/bronchial pre-neoplastic and neoplastic lesions was inversely related to malignancy, which implied that visualizing these factors could be a useful diagnostic procedure for suspected lung cancer. Finalizing this conclusion will require a wider study in a randomized and prospective trial.

Activation of endogenous angiotensin converting enzyme 2 prevents early injuries induced by hyperglycemia in rat retina

Diabetic retinopathy (DR) is a serious complication of diabetes mellitus that may result in blindness. We evaluated the effects of activation of endogenous angiotensin converting enzyme (ACE) 2 on the early stages of DR. Rats were administered an intravenous injection of streptozotocin to induce hyperglycemia. The ACE2 activator 1-[[2-(dimethylamino) ethyl] amino]-4-(hydroxymethyl)-7-[[(4-methylphenyl) sulfonyl] oxy]-9H-xanthone 9 (XNT) was administered by daily gavage. The death of retinal ganglion cells (RGC) was evaluated in histological sections, and retinal ACE2, caspase-3, and vascular endothelial growth factor (VEGF) expressions were analyzed by immunohistochemistry. XNT treatment increased ACE2 expression in retinas of hyperglycemic (HG) rats (control: 13.81±2.71 area%; HG: 14.29±4.30 area%; HG+XNT: 26.87±1.86 area%; P<0.05). Importantly, ACE2 activation significantly increased the RCG number in comparison with HG animals (control: 553.5±14.29; HG: 530.8±10.3 cells; HG+XNT: 575.3±16.5 cells; P<0.05). This effect was accompanied by a reduction in the expression of caspase-3 in RGC of the HG+XNT group when compared with untreated HG rats (control: 18.74±1.59; HG: 38.39±3.39 area%; HG+XNT: 27.83±2.80 area%; P<0.05). Treatment with XNT did not alter the VEGF expression in HG animals (P>0.05). Altogether, these findings indicate that activation of ACE2 reduced the death of retinal ganglion cells by apoptosis in HG rats.