Reconstrução de contornos e cumeeiras de telhados de edifícios a partir de imagens aéreas de alta-resolução e poliedros representativos de edifícios extraídos de dados LASER

Pós-graduação em Ciências Cartográficas - FCT

Comparação da dor pós-operatória em cães versus gatos após orquiectomia versus ovariohisterectomia

Pós-graduação em Anestesiologia - FMB

Concentração sérica da proteína C reativa como indicador preditivo do prognóstico clínico em indivíduos com hemorragia subaracnóidea aneurísmática

Pós-graduação em Bases Gerais da Cirurgia - FMB

Análise morfológica das células beta-pancreáticas de ratas diabéticas em diferentes idades de vida

Pós-graduação em Ginecologia, Obstetrícia e Mastologia - FMB

Adaptação Transcultural Brasil-Portugal da Escala de Satisfação com o Suporte Social para Estudantes do Ensino Superior

Realizou-se adaptação transcultural da Escala de Satisfação com o Suporte Social (ESSS) para a língua portuguesa. As qualidades psicométricas foram avaliadas numa amostra de 1.023 estudantes do ensino superior do Brasil e de Portugal. A partir dos resultados obtidos propõe-se uma versão modificada da ESSS com 12 itens que avaliam 4 dimensões. A versão modificada revelou adequada confiabilidade, validade fatorial, validade concorrente, divergente e discriminante com exceção dessa última para Satisfação com as Amizades e a Intimidade. A validade convergente esteve no limite do aceitável. Observou-se invariância dos pesos fatoriais entre Brasil e Portugal, permitindo sua utilização para a avaliação da Satisfação com o Suporte Social em estudantes do ensino superior de ambos os países.

Aderência aço-concreto: simulação numéricadosensaios de arranchamento pull-out e APULOT usando o programa ATENA

The bond between steel and concrete is essential for the existence of reinforced concrete structures, as both materials act together to absorb structural strain. The bond phenomenon is considered to be complex regarding many factors that affect it. Several types of bond tests have been proposed over years. One is the modified proposed of pull-out test, which was elaborated by Lorrain and Barbosa [1] called APULOT test (Appropriete pull-out-test). Based on experimental results obtained by Vale Silva[2] either by conventional pull-out tests, or by modified pull-out test, APULOT, seeks to know the numeric behavior of bond steel-concrete through a numerical simulation using a calculation code ATENA which is based on the Finite Element Method (FEM). The numerical simulation provided better evaluate the stress distribution and cracking that occurs during the test, thereby becoming a valuable tool to support the experimental project that aims to validation, validation partially or not recommend the modified bond test steel-concrete - APULOT test - as quality control test of structural concrete. The numerical results showed good representation compared to experimental results.

Avaliação sorológica de Parainfluenzavirus Tipo 1, Salmonella spp., Mycoplasma spp. e Toxoplasma gondii em aves silvestres

Newcastle disease, salmonellosis and mycoplamosis are the most important infectious diseases in poultry. Toxoplamosis is a common disease in urban environment. The present study investigated serologic evidence of these diseases in captive and wildlife birds, with rapid plate agglutination test, haemagglutination inhibition test, and modified agglutination test. In a total of 117 blood serum samples, 20 showed the presence of Toxoplasma gondii, Mycoplasma gallisepticum, and Salmonella spp. antibodies. Amazona aestiva was the specie with the highest number of positive individuals (13/20). We also verified the first detection of T. gondii antibodies in birds of prey from Mivalgo chimachima and Rupornis magnirostris species.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Influence of parity on concentrations of enzymes, proteins, and minerals in the milk of cows

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Effect of thermal modification on the physical properties of juvenile and mature woods of Eucalyptus grandis

This study aimed to evaluate the effect of thermal treatment on the physical properties of juvenile and mature woods of Eucalyptus grandis. Boards were taken from 30-year-old E. grandis trees. The boards were thermally modified at 180 °C in the Laboratory of Wood Drying and Preservation at UNESP, Botucatu, Sao Paulo state, Brazil. The results showed that thermal modification caused: (1) decrease of 6.8% in the density at 0% equilibrium moisture content of mature wood; (2) significant decreases of 14.7% and 35.6% in the maximum volumetric swellings of juvenile and mature woods, respectively; (3) significant decreases of 13.7% and 21.3% in the equilibrium moisture content of juvenile and mature woods, respectively. The influence of thermal modification in juvenile wood was lower than in mature wood and caused greater uniformity in the physical variations between these types of wood in E. grandis.

Behavior of the brown-rot fungus Gloeophyllum trabeum on thermally-modified Eucalyptus grandis wood

In this study, we aimed evaluate the behavior of the brown-rot fungus Gloeophylum trabeum and white-rot fungus Pycnoporus sanguineus on thermally-modified Eucalyptus grandis wood. To this end, boards from five-year-eleven-month-old E. grandis trees, taken from the Duratex-SA company stock, were thermally-modified between 180 ºC and 220 ºC in the Laboratory of Wood Drying and Preservation at Universidade Estadual Paulista - UNESP, Botucatu, Sao Paulo state Brazil. Samples of each treatment were tested according to the ASTM D-2017 (2008) technical norm. The accelerated decay caused by the brown-rot fungus G. trabeum was compared with the decay caused by the white-rot fungus P. sanguineus, studied by Calonego et al. (2010). The results showed that (1) brown-rot fungus caused greater decay than white-rot fungus; and (2) the increase in temperature from 180 to 220 ºC caused reductions between 28.2% and 70.0% in the weight loss of E. grandis samples incubated with G. trabeum.

Efeito da cafeína no desenvolvimento de Aedes aegypti (Diptera: Culicidae): o significado biológico das alterações do padrão de síntese de esterases

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Diferentes técnicas de diagnóstico empregadas na estimativa de prevalência populacional de infecção por Cryptosporidium felis em gatos domiciliados no município de Araçatuba, São Paulo

Pós-graduação em Medicina Veterinária - FCAV

Desenvolvimento de biossensor baseado em extrato de açaí e sensor biomimético para detecção de hexazinona

Pós-graduação em Química - IQ

Modificação da superfície de óxidos de ferro por dextrana derivatizada para aplicações em liberação de fármaco

Pós-graduação em Química - IQ